Rmu_sc0005693.1_g000003

carboxylesterase 15

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005693.1
OG0000918
Physical Location & Seq
Reverse (-)
6926 .. 7930
1005 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005693.1_g000003.1.cds

Sequence Viewer

Length: 1005 bp
atggtccaagagaagaaggtggttattcaagtatctgactggcttagagtatacgacgacggctcagtcgaccggacatggacaggactcccggagttcactttcctatttcattcggtttcacctcacgaggaattcatcaatggcgttgccacaaaagacgtggtcattgacaaaacatccgaccatcgcgtccgaatatacctaccggagagaaagccgaaggacaatgacgacactaagctacccataatccttcatttccatggagggggcttttgcatttccgaagccgattggtacatgtactactacatctactccaagatcacacgcgcggccaacgctattgttatctccgtctatctaagacaagcccccgagcaccgtcttccagctcagatagacgacagcttcagtgctctcctctggctacgatctgtggctcaagcagattcgtatgaaccgtggttaaatgaacatgcagacttgaaccgcattttcctcataggggacagttcaggaggaaacattgtccatgaagtggctgctcgggcagggaatgcggatttgggtcagttcaagttatccggtgggattcttatccaacctggctttgtccgggtaacgaggagcaagtcggagttggaacagccacagacatcattttttaacgtagatatggtggacaagttgttcagcttttcacttccgatggggtcaaccaaagaccatcggatcacatgtccgatgggttcattggccccgcctctggacagtctgaagctgcctccgatgctcattttcattggtgggatcgacatatttcaggacactgagatggaatactatgaggccatgaagaaggctaaccacgatgtgcagctcttgactatccccggaatgagacatgcgttttatctgaacgcggacatggacccacgcatggctgccccaactgaaagtctagtttctggggtggtagagttcgtcaagaagcattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0009056 GO:0016787
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

334

Amino Acids

37.77

Weight (kDa)

5.63

Isoelectric Point (pI)

34.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 65, 191
AccB7I CCANNNNNTGG 1 cut(s) 544
AccI GTMKAC 2 cut(s) 51, 69
AccII CGCG 4 cut(s) 192, 336, 338, 929
AciI CCGC 5 cut(s) 338, 496, 566, 767, 929
AclWI GGATC 2 cut(s) 746, 824
AcoI YGGCCR 1 cut(s) 339
AcsI RAATTY 1 cut(s) 134
AcuI CTGAAG 2 cut(s) 400, 803
AdeI CACNNNGTG 1 cut(s) 880
AfaI GTAC 2 cut(s) 302, 308
AfiI CCNNNNNNNGG 5 cut(s) 271, 511, 544, 772, 946
AflIII ACRYGT 2 cut(s) 303, 743
AgsI TTSAA 3 cut(s) 29, 493, 583
AjiI CACGTC 1 cut(s) 163
AjnI CCWGG 1 cut(s) 610
AjuI GAANNNNNNNTTGG 2 cut(s) 554, 586
AloI GAACNNNNNNTCC 2 cut(s) 680, 712
AluBI AGCT 6 cut(s) 244, 398, 414, 702, 787, 886
AluI AGCT 6 cut(s) 244, 398, 414, 702, 787, 886
Alw21I GWGCWC 2 cut(s) 387, 424
Alw26I GTCTC 1 cut(s) 901
AlwI GGATC 2 cut(s) 746, 824
Ama87I CYCGRG 2 cut(s) 380, 552
AoxI GGCC 3 cut(s) 339, 762, 855
ApeKI GCWGC 4 cut(s) 548, 787, 883, 950
ApoI RAATTY 1 cut(s) 134
AspLEI GCGC 1 cut(s) 338
AspS9I GGNCC 3 cut(s) 4, 763, 937
AsuC2I CCSGG 3 cut(s) 92, 623, 900
AsuHPI GGTGA 1 cut(s) 114
AvaI CYCGRG 2 cut(s) 380, 552
AvaII GGWCC 2 cut(s) 4, 937
BauI CACGAG 1 cut(s) 128
BbsI GAAGAC 1 cut(s) 383
Bbv12I GWGCWC 2 cut(s) 387, 424
BbvI GCAGC 4 cut(s) 535, 774, 895, 937
BccI CCATC 5 cut(s) 195, 709, 741, 745, 835
BceAI ACGGC 1 cut(s) 76
BciT130I CCWGG 1 cut(s) 612
BcnI CCSGG 3 cut(s) 92, 623, 900
BcoDI GTCTC 1 cut(s) 901
BfaI CTAG 1 cut(s) 968
BisI GCNGC 5 cut(s) 339, 549, 788, 884, 951
BlsI GCNGC 5 cut(s) 340, 550, 789, 885, 952
Bme1390I CCNGG 4 cut(s) 92, 612, 623, 900
Bme18I GGWCC 2 cut(s) 4, 937
BmeT110I CYCGRG 2 cut(s) 380, 552
BmgBI CACGTC 1 cut(s) 163
BmgT120I GGNCC 3 cut(s) 4, 763, 937
BmiI GGNNCC 2 cut(s) 765, 939
BmrFI CCNGG 4 cut(s) 92, 612, 623, 900
BmsI GCATC 1 cut(s) 786
BpiI GAAGAC 1 cut(s) 383
BpuEI CTTGAG 1 cut(s) 432
BpuMI CCSGG 3 cut(s) 92, 623, 900
BsaBI GATNNNNATC 1 cut(s) 602
BsaJI CCNNGG 3 cut(s) 265, 467, 898
BsaWI WCCGGW 3 cut(s) 72, 208, 590
BsaXI ACNNNNNCTCC 2 cut(s) 305, 335
Bsc4I CCNNNNNNNGG 5 cut(s) 271, 511, 544, 772, 946
Bse1I ACTGG 1 cut(s) 44
Bse8I GATNNNNATC 1 cut(s) 602
BseBI CCWGG 1 cut(s) 612
BseDI CCNNGG 3 cut(s) 265, 467, 898
BseGI GGATG 1 cut(s) 179
BseJI GATNNNNATC 1 cut(s) 602
BseLI CCNNNNNNNGG 5 cut(s) 271, 511, 544, 772, 946
BseMII CTCAG 3 cut(s) 78, 413, 828
BseNI ACTGG 1 cut(s) 44
BseRI GAGGAG 2 cut(s) 416, 646
BseXI GCAGC 4 cut(s) 535, 774, 895, 937
BsgI GTGCAG 1 cut(s) 902
Bsh1236I CGCG 4 cut(s) 192, 336, 338, 929
Bsh1285I CGRYCG 1 cut(s) 73
BshFI GGCC 3 cut(s) 341, 764, 857
BsiEI CGRYCG 1 cut(s) 73
BsiHKAI GWGCWC 2 cut(s) 387, 424
BsiHKCI CYCGRG 2 cut(s) 380, 552
BsiSI CCGG 6 cut(s) 73, 92, 209, 591, 622, 900
BslFI GGGAC 1 cut(s) 527
BslI CCNNNNNNNGG 5 cut(s) 271, 511, 544, 772, 946
BsmAI GTCTC 1 cut(s) 901
BsmFI GGGAC 1 cut(s) 527
BsmI GAATGC 1 cut(s) 568
BsnI GGCC 3 cut(s) 341, 764, 857
BsoBI CYCGRG 2 cut(s) 380, 552
Bsp1286I GDGCHC 2 cut(s) 387, 424
Bsp143I GATC 4 cut(s) 327, 437, 738, 816
Bsp19I CCATGG 1 cut(s) 265
BspACI CCGC 5 cut(s) 338, 496, 566, 767, 929
BspANI GGCC 3 cut(s) 341, 764, 857
BspCNI CTCAG 3 cut(s) 77, 412, 829
BspFNI CGCG 4 cut(s) 192, 336, 338, 929
BspLI GGNNCC 2 cut(s) 765, 939
BspPI GGATC 2 cut(s) 746, 824
BsrI ACTGG 1 cut(s) 44
BssECI CCNNGG 3 cut(s) 265, 467, 898
BssMI GATC 4 cut(s) 327, 437, 738, 816
BssNAI GTATAC 1 cut(s) 52
BssSI CACGAG 1 cut(s) 128
BssT1I CCWWGG 1 cut(s) 265
Bst1107I GTATAC 1 cut(s) 52
Bst2BI CACGAG 1 cut(s) 128
Bst2UI CCWGG 1 cut(s) 612
Bst4CI ACNGT 4 cut(s) 389, 468, 518, 779
BstAPI GCANNNNNTGC 1 cut(s) 563
BstDEI CTNAG 6 cut(s) 44, 64, 240, 368, 399, 837
BstDSI CCRYGG 2 cut(s) 265, 467
BstF5I GGATG 1 cut(s) 179
BstFNI CGCG 4 cut(s) 192, 336, 338, 929
BstHHI GCGC 1 cut(s) 338
BstKTI GATC 4 cut(s) 330, 440, 741, 819
BstMAI GTCTC 1 cut(s) 901
BstMBI GATC 4 cut(s) 327, 437, 738, 816
BstMCI CGRYCG 1 cut(s) 73
BstMWI GCNNNNNNNGC 4 cut(s) 344, 554, 563, 796
BstNI CCWGG 1 cut(s) 612
BstNSI RCATGY 4 cut(s) 307, 485, 747, 914
BstSCI CCNGG 4 cut(s) 90, 610, 621, 898
BstUI CGCG 4 cut(s) 192, 336, 338, 929
BstV1I GCAGC 4 cut(s) 535, 774, 895, 937
BstV2I GAAGAC 1 cut(s) 383
BstZ17I GTATAC 1 cut(s) 52
BsuRI GGCC 3 cut(s) 341, 764, 857
BtgI CCRYGG 2 cut(s) 265, 467
BtgZI GCGATG 1 cut(s) 173
BtrI CACGTC 1 cut(s) 163
BtsCI GGATG 1 cut(s) 179
BtsIMutI CAGTG 2 cut(s) 424, 834
CfoI GCGC 1 cut(s) 338
Cfr13I GGNCC 3 cut(s) 4, 763, 937
CseI GACGC 1 cut(s) 181
Csp6I GTAC 2 cut(s) 301, 307
CspCI CAANNNNNGTGG 2 cut(s) 144, 179
CviQI GTAC 2 cut(s) 301, 307
DdeI CTNAG 6 cut(s) 44, 64, 240, 368, 399, 837
DpnI GATC 4 cut(s) 329, 439, 740, 818
DpnII GATC 4 cut(s) 327, 437, 738, 816
DraIII CACNNNGTG 1 cut(s) 880
DrdI GACNNNNNNGTC 2 cut(s) 65, 191
DseDI GACNNNNNNGTC 2 cut(s) 65, 191
EaeI YGGCCR 1 cut(s) 339
Eco130I CCWWGG 1 cut(s) 265
Eco47I GGWCC 2 cut(s) 4, 937
Eco57I CTGAAG 2 cut(s) 400, 803
Eco88I CYCGRG 2 cut(s) 380, 552
EcoRI GAATTC 1 cut(s) 134
EcoRII CCWGG 1 cut(s) 610
EcoT14I CCWWGG 1 cut(s) 265
ErhI CCWWGG 1 cut(s) 265
FaqI GGGAC 1 cut(s) 527
FauI CCCGC 1 cut(s) 774
FblI GTMKAC 2 cut(s) 51, 69
Fnu4HI GCNGC 5 cut(s) 339, 549, 788, 884, 951
FokI GGATG 1 cut(s) 166
Fsp4HI GCNGC 5 cut(s) 339, 549, 788, 884, 951
FspBI CTAG 1 cut(s) 968
GlaI GCGC 1 cut(s) 337
GluI GCNGC 5 cut(s) 339, 549, 788, 884, 951
HaeIII GGCC 3 cut(s) 341, 764, 857
HapII CCGG 6 cut(s) 73, 92, 209, 591, 622, 900
HgaI GACGC 1 cut(s) 181
HhaI GCGC 1 cut(s) 338
Hin6I GCGC 1 cut(s) 336
HinP1I GCGC 1 cut(s) 336
HincII GTYRAC 2 cut(s) 70, 723
HindII GTYRAC 2 cut(s) 70, 723
HinfI GANTC 3 cut(s) 87, 455, 598
HpaII CCGG 6 cut(s) 73, 92, 209, 591, 622, 900
HphI GGTGA 1 cut(s) 114
Hpy166II GTNNAC 5 cut(s) 52, 70, 99, 688, 723
Hpy188III TCNNGA 6 cut(s) 128, 522, 773, 830, 889, 994
Hpy8I GTNNAC 5 cut(s) 52, 70, 99, 688, 723
Hpy99I CGWCG 2 cut(s) 59, 62
HpyAV CCTTC 4 cut(s) 10, 217, 266, 859
HpyCH4III ACNGT 4 cut(s) 389, 468, 518, 779
HpyCH4IV ACGT 2 cut(s) 162, 675
HpyCH4V TGCA 3 cut(s) 282, 485, 883
HpyF10VI GCNNNNNNNGC 4 cut(s) 344, 554, 563, 796
HpyF3I CTNAG 6 cut(s) 44, 64, 240, 368, 399, 837
HpySE526I ACGT 2 cut(s) 162, 675
HspAI GCGC 1 cut(s) 336
Kzo9I GATC 4 cut(s) 327, 437, 738, 816
LmnI GCTCC 1 cut(s) 633
Lsp1109I GCAGC 4 cut(s) 535, 774, 895, 937
LweI GCATC 1 cut(s) 786
MaeI CTAG 1 cut(s) 968
MaeII ACGT 2 cut(s) 162, 675
MaeIII GTNAC 1 cut(s) 625
MalI GATC 4 cut(s) 329, 439, 740, 818
MboI GATC 4 cut(s) 327, 437, 738, 816
MboII GAAGA 3 cut(s) 25, 383, 874
MhlI GDGCHC 2 cut(s) 387, 424
MluCI AATT 1 cut(s) 134
MlyI GAGTC 1 cut(s) 81
MmeI TCCRAC 4 cut(s) 207, 621, 627, 631
MseI TTAA 2 cut(s) 473, 672
MslI CAYNNNNRTG 2 cut(s) 264, 839
MspI CCGG 6 cut(s) 73, 92, 209, 591, 622, 900
MspR9I CCNGG 4 cut(s) 92, 612, 623, 900
Mva1269I GAATGC 1 cut(s) 568
MvaI CCWGG 1 cut(s) 612
MvnI CGCG 4 cut(s) 192, 336, 338, 929
MwoI GCNNNNNNNGC 4 cut(s) 344, 554, 563, 796
NciI CCSGG 3 cut(s) 92, 623, 900
NcoI CCATGG 1 cut(s) 265
NdeII GATC 4 cut(s) 327, 437, 738, 816
NlaIV GGNNCC 2 cut(s) 765, 939
NspI RCATGY 4 cut(s) 307, 485, 747, 914
PciI ACATGT 2 cut(s) 303, 743
PcsI WCGNNNNNNNCGW 2 cut(s) 66, 464
PctI GAATGC 1 cut(s) 568
PfeI GAWTC 2 cut(s) 455, 598
PflFI GACNNNGTC 1 cut(s) 164
PflMI CCANNNNNTGG 1 cut(s) 544
PfoI TCCNGGA 1 cut(s) 90
PkrI GCNGC 5 cut(s) 340, 550, 789, 885, 952
PleI GAGTC 1 cut(s) 81
PpsI GAGTC 1 cut(s) 81
PscI ACATGT 2 cut(s) 303, 743
Psp6I CCWGG 1 cut(s) 610
PspGI CCWGG 1 cut(s) 610
PspN4I GGNNCC 2 cut(s) 765, 939
PspPI GGNCC 3 cut(s) 4, 763, 937
PsyI GACNNNGTC 1 cut(s) 164
RsaI GTAC 2 cut(s) 302, 308
RsaNI GTAC 2 cut(s) 301, 307
RseI CAYNNNNRTG 2 cut(s) 264, 839
SalI GTCGAC 1 cut(s) 68
SaqAI TTAA 2 cut(s) 473, 672
SatI GCNGC 5 cut(s) 339, 549, 788, 884, 951
Sau3AI GATC 4 cut(s) 327, 437, 738, 816
Sau96I GGNCC 3 cut(s) 4, 763, 937
SchI GAGTC 1 cut(s) 81
ScrFI CCNGG 4 cut(s) 92, 612, 623, 900
SduI GDGCHC 2 cut(s) 387, 424
SfaNI GCATC 1 cut(s) 786
SinI GGWCC 2 cut(s) 4, 937
SmiMI CAYNNNNRTG 2 cut(s) 264, 839
SmlI CTYRAG 1 cut(s) 447
SmoI CTYRAG 1 cut(s) 447
Sse9I AATT 1 cut(s) 134
SsiI CCGC 5 cut(s) 338, 496, 566, 767, 929
SspMI CTAG 1 cut(s) 968
StyD4I CCNGG 4 cut(s) 90, 610, 621, 898
StyI CCWWGG 1 cut(s) 265
TaaI ACNGT 4 cut(s) 389, 468, 518, 779
TaiI ACGT 2 cut(s) 165, 678
TaqI TCGA 2 cut(s) 69, 819
TasI AATT 1 cut(s) 134
TatI WGTACW 1 cut(s) 306
TauI GCSGC 1 cut(s) 341
TfiI GAWTC 2 cut(s) 455, 598
Tru1I TTAA 2 cut(s) 473, 672
Tru9I TTAA 2 cut(s) 473, 672
TscAI CASTG 2 cut(s) 424, 841
TseI GCWGC 4 cut(s) 548, 787, 883, 950
TspDTI ATGAA 9 cut(s) 101, 127, 248, 477, 492, 555, 747, 796, 875
TspGWI ACGGA 1 cut(s) 349
TspRI CASTG 2 cut(s) 424, 841
Tth111I GACNNNGTC 1 cut(s) 164
Van91I CCANNNNNTGG 1 cut(s) 544
VpaK11BI GGWCC 2 cut(s) 4, 937
XapI RAATTY 1 cut(s) 134
XceI RCATGY 4 cut(s) 307, 485, 747, 914
XcmI CCANNNNNNNNNTGG 1 cut(s) 160
XmiI GTMKAC 2 cut(s) 51, 69
XspI CTAG 1 cut(s) 968
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.