Rmu_co8475729.1_g000001

Protein DJ-1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8475729.1
Physical Location & Seq
Reverse (-)
1 .. 2075
2075 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8475729.1_g000001.1.cds

Sequence Viewer

Length: 168 bp
atggaggcagtgatcgccgtcgctgttccacaccgagccggagctgatgtcactgtggcttttgtggagaagaagctgagggttgaggcttgtgatggggttaagatcatcgctgaagctttggtttcggactgtggccaaagctccttcgatctcattactctacct

Protein Analysis

56

Amino Acids

5.85

Weight (kDa)

4.75

Isoelectric Point (pI)

36.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 136
AcuI CTGAAG 1 cut(s) 135
AluBI AGCT 4 cut(s) 44, 76, 119, 144
AluI AGCT 4 cut(s) 44, 76, 119, 144
AoxI GGCC 1 cut(s) 136
BalI TGGCCA 1 cut(s) 138
BbvCI CCTCAGC 1 cut(s) 77
BccI CCATC 1 cut(s) 89
BceAI ACGGC 1 cut(s) 2
Bpu10I CCTNAGC 1 cut(s) 77
BsaXI ACNNNNNCTCC 2 cut(s) 33, 63
BseMII CTCAG 1 cut(s) 68
BshFI GGCC 1 cut(s) 138
BsiSI CCGG 1 cut(s) 39
BsnI GGCC 1 cut(s) 138
Bsp143I GATC 3 cut(s) 12, 105, 151
BspANI GGCC 1 cut(s) 138
BspCNI CTCAG 1 cut(s) 69
BssMI GATC 3 cut(s) 12, 105, 151
Bst4CI ACNGT 2 cut(s) 55, 134
BstDEI CTNAG 1 cut(s) 77
BstKTI GATC 3 cut(s) 15, 108, 154
BstMBI GATC 3 cut(s) 12, 105, 151
BstMWI GCNNNNNNNGC 1 cut(s) 14
BsuRI GGCC 1 cut(s) 138
BtgZI GCGATG 1 cut(s) 94
BtsI GCAGTG 1 cut(s) 15
BtsIMutI CAGTG 2 cut(s) 15, 51
CviJI RGCY 8 cut(s) 38, 44, 59, 76, 89, 119, 138, 144
CviKI_1 RGCY 8 cut(s) 38, 44, 59, 76, 89, 119, 138, 144
DdeI CTNAG 1 cut(s) 77
DpnI GATC 3 cut(s) 14, 107, 153
DpnII GATC 3 cut(s) 12, 105, 151
EaeI YGGCCR 1 cut(s) 136
Eco57I CTGAAG 1 cut(s) 135
HaeIII GGCC 1 cut(s) 138
HapII CCGG 1 cut(s) 39
HindIII AAGCTT 1 cut(s) 117
HpaII CCGG 1 cut(s) 39
Hpy188I TCNGA 1 cut(s) 130
Hpy99I CGWCG 1 cut(s) 23
HpyAV CCTTC 1 cut(s) 157
HpyCH4III ACNGT 2 cut(s) 55, 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 14
HpyF3I CTNAG 1 cut(s) 77
Kzo9I GATC 3 cut(s) 12, 105, 151
LmnI GCTCC 2 cut(s) 41, 149
LpnPI CCDG 1 cut(s) 52
MaeIII GTNAC 1 cut(s) 49
MalI GATC 3 cut(s) 14, 107, 153
MboI GATC 3 cut(s) 12, 105, 151
MboII GAAGA 1 cut(s) 82
MlsI TGGCCA 1 cut(s) 138
MluNI TGGCCA 1 cut(s) 138
MnlI CCTC 2 cut(s) 72, 79
Mox20I TGGCCA 1 cut(s) 138
MscI TGGCCA 1 cut(s) 138
MseI TTAA 1 cut(s) 102
Msp20I TGGCCA 1 cut(s) 138
MspI CCGG 1 cut(s) 39
MwoI GCNNNNNNNGC 1 cut(s) 14
NdeII GATC 3 cut(s) 12, 105, 151
NmuCI GTSAC 1 cut(s) 49
SaqAI TTAA 1 cut(s) 102
Sau3AI GATC 3 cut(s) 12, 105, 151
SetI ASST 4 cut(s) 46, 78, 121, 146
SgeI CNNG 3 cut(s) 47, 51, 102
TaaI ACNGT 2 cut(s) 55, 134
TaqI TCGA 1 cut(s) 150
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TscAI CASTG 2 cut(s) 15, 58
TseFI GTSAC 1 cut(s) 49
Tsp45I GTSAC 1 cut(s) 49
TspRI CASTG 2 cut(s) 15, 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.