Rh2AG182700

Bile acid sodium symporter

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
17697327 .. 17699938
2612 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG182700.1

Sequence Viewer

Length: 306 bp
ATGCAGAAGACGAAGCTATCCGAGATGGCGGAGGCGAACGCGCTGTGCTTCAATTTCCTTAACCTCTACACTGTCGACCGCCGCCGCCACCTCCTCTCAAAGCTCCAAAACAAACCACCTCCAGTCCCCAAAGACACCCTGGACTTCCCCCTCACAGGTGATGCCTTTATCAGGGTATTTTGTGAGCAAGGTTTGATATTGGTTGCGTGCTGCCCTGGTGGAACAACAAGTAACATTGTCACTTATATTGCACGGGATATGCAGCTCGGGAGTTTGCCAAGTAGGGGGTTAAGCCAGGAAAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.23

Weight (kDa)

8.43

Isoelectric Point (pI)

51.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 75
AccII CGCG 1 cut(s) 41
AciI CCGC 4 cut(s) 29, 79, 82, 85
AfiI CCNNNNNNNGG 3 cut(s) 155, 171, 284
AgsI TTSAA 1 cut(s) 52
AjnI CCWGG 3 cut(s) 138, 214, 294
AluBI AGCT 3 cut(s) 16, 103, 265
AluI AGCT 3 cut(s) 16, 103, 265
Ama87I CYCGRG 1 cut(s) 266
ApeKI GCWGC 2 cut(s) 210, 262
AspLEI GCGC 1 cut(s) 43
AsuHPI GGTGA 1 cut(s) 170
AvaI CYCGRG 1 cut(s) 266
BbsI GAAGAC 1 cut(s) 14
BbvI GCAGC 2 cut(s) 197, 274
BccI CCATC 1 cut(s) 19
BciT130I CCWGG 3 cut(s) 140, 216, 296
BfaI CTAG 1 cut(s) 304
BisI GCNGC 4 cut(s) 82, 85, 211, 263
BlsI GCNGC 4 cut(s) 83, 86, 212, 264
Bme1390I CCNGG 3 cut(s) 140, 216, 296
BmeT110I CYCGRG 1 cut(s) 266
BmrFI CCNGG 3 cut(s) 140, 216, 296
BmsI GCATC 1 cut(s) 151
BpiI GAAGAC 1 cut(s) 14
BpmI CTGGAG 1 cut(s) 105
BsaJI CCNNGG 2 cut(s) 138, 214
Bsc4I CCNNNNNNNGG 3 cut(s) 155, 171, 284
Bse1I ACTGG 1 cut(s) 122
BseBI CCWGG 3 cut(s) 140, 216, 296
BseDI CCNNGG 2 cut(s) 138, 214
BseLI CCNNNNNNNGG 3 cut(s) 155, 171, 284
BseNI ACTGG 1 cut(s) 122
BseRI GAGGAG 1 cut(s) 83
BseXI GCAGC 2 cut(s) 197, 274
Bsh1236I CGCG 1 cut(s) 41
Bsh1285I CGRYCG 1 cut(s) 79
BsiEI CGRYCG 1 cut(s) 79
BsiHKCI CYCGRG 1 cut(s) 266
BslFI GGGAC 1 cut(s) 110
BslI CCNNNNNNNGG 3 cut(s) 155, 171, 284
BsmFI GGGAC 1 cut(s) 110
BsoBI CYCGRG 1 cut(s) 266
BspACI CCGC 4 cut(s) 29, 79, 82, 85
BspFNI CGCG 1 cut(s) 41
BsrI ACTGG 1 cut(s) 122
BssECI CCNNGG 2 cut(s) 138, 214
Bst2UI CCWGG 3 cut(s) 140, 216, 296
Bst4CI ACNGT 1 cut(s) 73
BstC8I GCNNGC 1 cut(s) 208
BstENI CCTNNNNNAGG 1 cut(s) 169
BstFNI CGCG 1 cut(s) 41
BstHHI GCGC 1 cut(s) 43
BstMCI CGRYCG 1 cut(s) 79
BstNI CCWGG 3 cut(s) 140, 216, 296
BstSCI CCNGG 3 cut(s) 138, 214, 294
BstUI CGCG 1 cut(s) 41
BstV1I GCAGC 2 cut(s) 197, 274
BstV2I GAAGAC 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 208
CfoI GCGC 1 cut(s) 43
CviJI RGCY 4 cut(s) 16, 103, 265, 294
CviKI_1 RGCY 4 cut(s) 16, 103, 265, 294
EciI GGCGGA 1 cut(s) 44
Eco88I CYCGRG 1 cut(s) 266
EcoNI CCTNNNNNAGG 1 cut(s) 169
EcoRII CCWGG 3 cut(s) 138, 214, 294
FaiI YATR 2 cut(s) 246, 260
FaqI GGGAC 1 cut(s) 110
FblI GTMKAC 1 cut(s) 75
Fnu4HI GCNGC 4 cut(s) 82, 85, 211, 263
Fsp4HI GCNGC 4 cut(s) 82, 85, 211, 263
FspBI CTAG 1 cut(s) 304
GlaI GCGC 1 cut(s) 42
GluI GCNGC 4 cut(s) 82, 85, 211, 263
GsuI CTGGAG 1 cut(s) 105
HhaI GCGC 1 cut(s) 43
Hin6I GCGC 1 cut(s) 41
HinP1I GCGC 1 cut(s) 41
HincII GTYRAC 1 cut(s) 76
HindII GTYRAC 1 cut(s) 76
HphI GGTGA 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 268
Hpy8I GTNNAC 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 3 cut(s) 4, 251, 262
HspAI GCGC 1 cut(s) 41
LmnI GCTCC 1 cut(s) 108
LpnPI CCDG 8 cut(s) 125, 135, 141, 152, 157, 201, 228, 281
Lsp1109I GCAGC 2 cut(s) 197, 274
LweI GCATC 1 cut(s) 151
MaeI CTAG 1 cut(s) 304
MaeIII GTNAC 2 cut(s) 230, 238
MboII GAAGA 1 cut(s) 19
MluCI AATT 1 cut(s) 52
MnlI CCTC 6 cut(s) 25, 74, 101, 104, 129, 161
MseI TTAA 2 cut(s) 60, 290
MspR9I CCNGG 3 cut(s) 140, 216, 296
MvaI CCWGG 3 cut(s) 140, 216, 296
MvnI CGCG 1 cut(s) 41
NmuCI GTSAC 1 cut(s) 238
PkrI GCNGC 4 cut(s) 83, 86, 212, 264
Psp6I CCWGG 3 cut(s) 138, 214, 294
PspGI CCWGG 3 cut(s) 138, 214, 294
SalI GTCGAC 1 cut(s) 74
SaqAI TTAA 2 cut(s) 60, 290
SatI GCNGC 4 cut(s) 82, 85, 211, 263
ScrFI CCNGG 3 cut(s) 140, 216, 296
SetI ASST 8 cut(s) 18, 66, 93, 105, 121, 160, 193, 267
SfaNI GCATC 1 cut(s) 151
Sse9I AATT 1 cut(s) 52
SsiI CCGC 4 cut(s) 29, 79, 82, 85
SspMI CTAG 1 cut(s) 304
StyD4I CCNGG 3 cut(s) 138, 214, 294
TaaI ACNGT 1 cut(s) 73
TaqI TCGA 1 cut(s) 75
TasI AATT 1 cut(s) 52
TauI GCSGC 2 cut(s) 84, 87
Tru1I TTAA 2 cut(s) 60, 290
Tru9I TTAA 2 cut(s) 60, 290
TscAI CASTG 1 cut(s) 76
TseFI GTSAC 1 cut(s) 238
TseI GCWGC 2 cut(s) 210, 262
Tsp45I GTSAC 1 cut(s) 238
TspRI CASTG 1 cut(s) 76
XagI CCTNNNNNAGG 1 cut(s) 169
XcmI CCANNNNNNNNNTGG 1 cut(s) 136
XmiI GTMKAC 1 cut(s) 75
XspI CTAG 1 cut(s) 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.