Rh2AG096900

histidine-containing phosphotransfer protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
8215612 .. 8220037
4426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG096900.1

Sequence Viewer

Length: 183 bp
ATGCACTCTGGCAGTGGTGCGAAGCGGCTTTGCGCCGGGGAGCGAAAGATAACTGAGGACTTCTGGATAAGTATGGCCTTGAGAGGGTTCTCGATACCTCAATCACAGAGATGCTTCAGGGCTTTCCAGAGAGTGAAACATGTGCATGAGGCATTAAAGAGGCAGTTTGAAACTCATTTCTAG

Protein Analysis

60

Amino Acids

7.05

Weight (kDa)

10.42

Isoelectric Point (pI)

46.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 25
AcuI CTGAAG 1 cut(s) 100
AfiI CCNNNNNNNGG 1 cut(s) 84
AflIII ACRYGT 1 cut(s) 139
AgsI TTSAA 1 cut(s) 170
AoxI GGCC 1 cut(s) 75
AspLEI GCGC 1 cut(s) 35
AsuC2I CCSGG 1 cut(s) 37
BcnI CCSGG 1 cut(s) 37
BfaI CTAG 1 cut(s) 181
BisI GCNGC 1 cut(s) 26
BlsI GCNGC 1 cut(s) 27
Bme1390I CCNGG 1 cut(s) 37
BmrFI CCNGG 1 cut(s) 37
BmsI GCATC 1 cut(s) 101
BpuEI CTTGAG 1 cut(s) 100
BpuMI CCSGG 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 84
BseMII CTCAG 1 cut(s) 45
BshFI GGCC 1 cut(s) 77
BsiSI CCGG 1 cut(s) 36
BslI CCNNNNNNNGG 1 cut(s) 84
BsnI GGCC 1 cut(s) 77
BspACI CCGC 1 cut(s) 25
BspANI GGCC 1 cut(s) 77
BspCNI CTCAG 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 54
BstHHI GCGC 1 cut(s) 35
BstNSI RCATGY 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 35
BsuRI GGCC 1 cut(s) 77
BtsI GCAGTG 1 cut(s) 19
BtsIMutI CAGTG 1 cut(s) 19
CfoI GCGC 1 cut(s) 35
CviAII CATG 2 cut(s) 140, 146
CviJI RGCY 3 cut(s) 28, 77, 122
CviKI_1 RGCY 3 cut(s) 28, 77, 122
DdeI CTNAG 1 cut(s) 54
Eco57I CTGAAG 1 cut(s) 100
FaeI CATG 2 cut(s) 143, 149
FaiI YATR 3 cut(s) 74, 141, 147
FatI CATG 2 cut(s) 139, 145
Fnu4HI GCNGC 1 cut(s) 26
Fsp4HI GCNGC 1 cut(s) 26
FspBI CTAG 1 cut(s) 181
GlaI GCGC 1 cut(s) 34
GluI GCNGC 1 cut(s) 26
HaeIII GGCC 1 cut(s) 77
HapII CCGG 1 cut(s) 36
HhaI GCGC 1 cut(s) 35
Hin1II CATG 2 cut(s) 143, 149
Hin6I GCGC 1 cut(s) 33
HinP1I GCGC 1 cut(s) 33
HpaII CCGG 1 cut(s) 36
Hpy188III TCNNGA 3 cut(s) 64, 91, 127
HpyCH4V TGCA 2 cut(s) 4, 145
HpyF3I CTNAG 1 cut(s) 54
Hsp92II CATG 2 cut(s) 143, 149
HspAI GCGC 1 cut(s) 33
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 4 cut(s) 49, 49, 103, 140
LweI GCATC 1 cut(s) 101
MaeI CTAG 1 cut(s) 181
MnlI CCTC 5 cut(s) 49, 77, 108, 142, 153
MseI TTAA 1 cut(s) 155
MslI CAYNNNNRTG 2 cut(s) 109, 144
MspI CCGG 1 cut(s) 36
MspR9I CCNGG 1 cut(s) 37
NciI CCSGG 1 cut(s) 37
NlaIII CATG 2 cut(s) 143, 149
NspI RCATGY 1 cut(s) 143
PciI ACATGT 1 cut(s) 139
PkrI GCNGC 1 cut(s) 27
PscI ACATGT 1 cut(s) 139
RseI CAYNNNNRTG 2 cut(s) 109, 144
SaqAI TTAA 1 cut(s) 155
SatI GCNGC 1 cut(s) 26
ScrFI CCNGG 1 cut(s) 37
SetI ASST 1 cut(s) 100
SfaNI GCATC 1 cut(s) 101
SmiMI CAYNNNNRTG 2 cut(s) 109, 144
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
SsiI CCGC 1 cut(s) 25
SspMI CTAG 1 cut(s) 181
StyD4I CCNGG 1 cut(s) 35
TaqI TCGA 1 cut(s) 92
TauI GCSGC 1 cut(s) 28
Tru1I TTAA 1 cut(s) 155
Tru9I TTAA 1 cut(s) 155
TscAI CASTG 1 cut(s) 19
TspRI CASTG 1 cut(s) 19
XceI RCATGY 1 cut(s) 143
XspI CTAG 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.