Rh2CG351300

Histidine kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
47437603 .. 47442346
4744 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG351300.1

Sequence Viewer

Length: 309 bp
ATGACGTCTGACACTAGAAATTTACACAATACTGAAGCAATAGCAGAAGCATTTGAGAAGTTAACAAAACGGAAAGACATTGTGACAATGAGGGATGCTCTAAACTCTGCCTTCGATGAGGAAATGTATGTCGATCTGAAAGTGTTTTTGATGGGTCAAGAGATGCCAGAAATGGATGGATTTGAGGCAACAAGGGAGATAAGGAAAGTGGAGAAAACTCACCATGTCCGCATTCCGATCATTGCATTAACAGCTTATACACCAGGTGAGGAAACAAGAAGGATGTTGGAGGCCGGCATGCATGGATGA

Protein Analysis

102

Amino Acids

11.76

Weight (kDa)

5.34

Isoelectric Point (pI)

36.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Response_reg PF00072 31 - 102 2.1e-08 Response regulator receiver domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 8
AciI CCGC 1 cut(s) 229
AcsI RAATTY 1 cut(s) 19
AcuI CTGAAG 1 cut(s) 54
AcyI GRCGYC 1 cut(s) 5
AdeI CACNNNGTG 1 cut(s) 266
AjnI CCWGG 1 cut(s) 262
AluBI AGCT 1 cut(s) 254
AluI AGCT 1 cut(s) 254
AoxI GGCC 1 cut(s) 291
ApoI RAATTY 1 cut(s) 19
AsuHPI GGTGA 2 cut(s) 212, 278
BccI CCATC 2 cut(s) 145, 170
BciT130I CCWGG 1 cut(s) 264
BfaI CTAG 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 264
BmrFI CCNGG 1 cut(s) 264
BmsI GCATC 2 cut(s) 85, 153
BplI GAGNNNNNCTC 2 cut(s) 82, 114
BsaHI GRCGYC 1 cut(s) 5
Bse118I RCCGGY 1 cut(s) 293
Bse3DI GCAATG 1 cut(s) 240
BseBI CCWGG 1 cut(s) 264
BseGI GGATG 3 cut(s) 100, 181, 288
BseMI GCAATG 1 cut(s) 240
BshFI GGCC 1 cut(s) 293
BsiSI CCGG 1 cut(s) 294
BsmI GAATGC 1 cut(s) 231
BsnI GGCC 1 cut(s) 293
Bsp143I GATC 2 cut(s) 133, 237
BspACI CCGC 1 cut(s) 229
BspANI GGCC 1 cut(s) 293
BsrDI GCAATG 1 cut(s) 240
BsrFI RCCGGY 1 cut(s) 293
BssAI RCCGGY 1 cut(s) 293
BssMI GATC 2 cut(s) 133, 237
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 264
BstACI GRCGYC 1 cut(s) 5
BstC8I GCNNGC 2 cut(s) 295, 299
BstF5I GGATG 3 cut(s) 100, 181, 288
BstKTI GATC 2 cut(s) 136, 240
BstMBI GATC 2 cut(s) 133, 237
BstMWI GCNNNNNNNGC 1 cut(s) 251
BstNI CCWGG 1 cut(s) 264
BstNSI RCATGY 1 cut(s) 301
BstSCI CCNGG 1 cut(s) 262
BsuRI GGCC 1 cut(s) 293
BtsCI GGATG 3 cut(s) 100, 181, 288
Cac8I GCNNGC 2 cut(s) 295, 299
Cfr10I RCCGGY 1 cut(s) 293
CsiI ACCWGGT 1 cut(s) 262
CviAII CATG 3 cut(s) 224, 298, 302
CviJI RGCY 2 cut(s) 254, 293
CviKI_1 RGCY 2 cut(s) 254, 293
DpnI GATC 2 cut(s) 135, 239
DpnII GATC 2 cut(s) 133, 237
DraIII CACNNNGTG 1 cut(s) 266
Eco57I CTGAAG 1 cut(s) 54
EcoRII CCWGG 1 cut(s) 262
EcoT22I ATGCAT 1 cut(s) 303
FaeI CATG 3 cut(s) 227, 301, 305
FaiI YATR 5 cut(s) 129, 225, 258, 299, 303
FatI CATG 3 cut(s) 223, 297, 301
FokI GGATG 3 cut(s) 107, 188, 295
FspBI CTAG 1 cut(s) 15
HaeIII GGCC 1 cut(s) 293
HapII CCGG 1 cut(s) 294
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 3 cut(s) 227, 301, 305
HincII GTYRAC 1 cut(s) 63
HindII GTYRAC 1 cut(s) 63
HpaI GTTAAC 1 cut(s) 63
HpaII CCGG 1 cut(s) 294
HphI GGTGA 2 cut(s) 212, 278
Hpy166II GTNNAC 1 cut(s) 63
Hpy188I TCNGA 3 cut(s) 10, 138, 237
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 63
HpyAV CCTTC 2 cut(s) 121, 273
HpyCH4IV ACGT 1 cut(s) 5
HpyCH4V TGCA 2 cut(s) 245, 301
HpyF10VI GCNNNNNNNGC 1 cut(s) 251
HpySE526I ACGT 1 cut(s) 5
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 3 cut(s) 227, 301, 305
KroI GCCGGC 1 cut(s) 293
KroNI GCCGGC 1 cut(s) 295
KspAI GTTAAC 1 cut(s) 63
Kzo9I GATC 2 cut(s) 133, 237
LpnPI CCDG 3 cut(s) 180, 249, 276
LweI GCATC 2 cut(s) 85, 153
MabI ACCWGGT 1 cut(s) 262
MaeI CTAG 1 cut(s) 15
MaeII ACGT 1 cut(s) 5
MaeIII GTNAC 1 cut(s) 82
MalI GATC 2 cut(s) 135, 239
MboI GATC 2 cut(s) 133, 237
MluCI AATT 1 cut(s) 19
MmeI TCCRAC 1 cut(s) 267
MnlI CCTC 5 cut(s) 84, 112, 178, 262, 283
Mph1103I ATGCAT 1 cut(s) 303
MroNI GCCGGC 1 cut(s) 293
MseI TTAA 2 cut(s) 62, 248
MspI CCGG 1 cut(s) 294
MspR9I CCNGG 1 cut(s) 264
Mva1269I GAATGC 1 cut(s) 231
MvaI CCWGG 1 cut(s) 264
MwoI GCNNNNNNNGC 1 cut(s) 251
NaeI GCCGGC 1 cut(s) 295
NdeII GATC 2 cut(s) 133, 237
NgoMIV GCCGGC 1 cut(s) 293
NlaIII CATG 3 cut(s) 227, 301, 305
NmuCI GTSAC 1 cut(s) 82
NsiI ATGCAT 1 cut(s) 303
NspI RCATGY 1 cut(s) 301
PaeI GCATGC 1 cut(s) 301
PctI GAATGC 1 cut(s) 231
PdiI GCCGGC 1 cut(s) 295
Psp6I CCWGG 1 cut(s) 262
PspGI CCWGG 1 cut(s) 262
SaqAI TTAA 2 cut(s) 62, 248
Sau3AI GATC 2 cut(s) 133, 237
ScrFI CCNGG 1 cut(s) 264
SetI ASST 3 cut(s) 8, 256, 268
SexAI ACCWGGT 1 cut(s) 262
SfaNI GCATC 2 cut(s) 85, 153
SgeI CNNG 8 cut(s) 27, 170, 179, 204, 236, 275, 276, 288
SphI GCATGC 1 cut(s) 301
Sse9I AATT 1 cut(s) 19
SsiI CCGC 1 cut(s) 229
SspMI CTAG 1 cut(s) 15
StyD4I CCNGG 1 cut(s) 262
TaiI ACGT 1 cut(s) 8
TaqI TCGA 2 cut(s) 114, 132
TasI AATT 1 cut(s) 19
Tru1I TTAA 2 cut(s) 62, 248
Tru9I TTAA 2 cut(s) 62, 248
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspGWI ACGGA 1 cut(s) 85
XapI RAATTY 1 cut(s) 19
XceI RCATGY 1 cut(s) 301
XspI CTAG 1 cut(s) 15
ZraI GACGTC 1 cut(s) 6
Zsp2I ATGCAT 1 cut(s) 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.