Rh1CG044300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
8409124 .. 8410451
1328 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG044300.1

Sequence Viewer

Length: 198 bp
ATGATAGAGTTATGTATGACAGTGAGGGATGCTCTAAACTCTGCCTTCGATGAGGAAATGTATGCCGATCTGACATTTTTGAACTACTACAAGATCAGCTCTGGTACCGGCCCAATCCTGTTGTGCGTTGTCATTGCGAGTACCAAAACAGGTTTGGATAGAATTTTGGACATAAGTTTTAGGAGATCTTATGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.32

Weight (kDa)

4.72

Isoelectric Point (pI)

58.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 104
AccB1I GGYRCC 1 cut(s) 104
AcsI RAATTY 1 cut(s) 162
AfaI GTAC 2 cut(s) 106, 142
AgsI TTSAA 1 cut(s) 82
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
AoxI GGCC 1 cut(s) 109
ApoI RAATTY 1 cut(s) 162
Asp718I GGTACC 1 cut(s) 104
AspS9I GGNCC 1 cut(s) 110
BanI GGYRCC 1 cut(s) 104
BfaI CTAG 1 cut(s) 196
BglII AGATCT 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 106
BmsI GCATC 1 cut(s) 19
BplI GAGNNNNNCTC 2 cut(s) 16, 48
Bse118I RCCGGY 1 cut(s) 107
Bse3DI GCAATG 1 cut(s) 132
BseGI GGATG 1 cut(s) 34
BseMI GCAATG 1 cut(s) 132
BshFI GGCC 1 cut(s) 111
BshNI GGYRCC 1 cut(s) 104
BsiSI CCGG 1 cut(s) 108
BsnI GGCC 1 cut(s) 111
Bsp143I GATC 3 cut(s) 67, 93, 185
BspANI GGCC 1 cut(s) 111
BspLI GGNNCC 1 cut(s) 106
BspT107I GGYRCC 1 cut(s) 104
BsrDI GCAATG 1 cut(s) 132
BsrFI RCCGGY 1 cut(s) 107
BssAI RCCGGY 1 cut(s) 107
BssMI GATC 3 cut(s) 67, 93, 185
Bst4CI ACNGT 1 cut(s) 22
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 3 cut(s) 70, 96, 188
BstMBI GATC 3 cut(s) 67, 93, 185
BstX2I RGATCY 1 cut(s) 185
BstYI RGATCY 1 cut(s) 185
BsuRI GGCC 1 cut(s) 111
BtsCI GGATG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 27
Cfr10I RCCGGY 1 cut(s) 107
Cfr13I GGNCC 1 cut(s) 110
Csp6I GTAC 2 cut(s) 105, 141
CviJI RGCY 2 cut(s) 99, 111
CviKI_1 RGCY 2 cut(s) 99, 111
CviQI GTAC 2 cut(s) 105, 141
DpnI GATC 3 cut(s) 69, 95, 187
DpnII GATC 3 cut(s) 67, 93, 185
FaiI YATR 5 cut(s) 13, 17, 63, 173, 192
FokI GGATG 1 cut(s) 41
FspBI CTAG 1 cut(s) 196
HaeIII GGCC 1 cut(s) 111
HapII CCGG 1 cut(s) 108
HpaII CCGG 1 cut(s) 108
Hpy188I TCNGA 1 cut(s) 72
HpyAV CCTTC 1 cut(s) 55
HpyCH4III ACNGT 1 cut(s) 22
KpnI GGTACC 1 cut(s) 108
Kzo9I GATC 3 cut(s) 67, 93, 185
LpnPI CCDG 4 cut(s) 87, 121, 131, 135
LweI GCATC 1 cut(s) 19
MaeI CTAG 1 cut(s) 196
MalI GATC 3 cut(s) 69, 95, 187
MboI GATC 3 cut(s) 67, 93, 185
MflI RGATCY 1 cut(s) 185
MluCI AATT 1 cut(s) 162
MnlI CCTC 2 cut(s) 18, 46
MspI CCGG 1 cut(s) 108
NdeII GATC 3 cut(s) 67, 93, 185
NlaIV GGNNCC 1 cut(s) 106
PspN4I GGNNCC 1 cut(s) 106
PspPI GGNCC 1 cut(s) 110
PsuI RGATCY 1 cut(s) 185
RsaI GTAC 2 cut(s) 106, 142
RsaNI GTAC 2 cut(s) 105, 141
Sau3AI GATC 3 cut(s) 67, 93, 185
Sau96I GGNCC 1 cut(s) 110
SetI ASST 2 cut(s) 101, 154
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 6 cut(s) 103, 114, 120, 130, 150, 162
Sse9I AATT 1 cut(s) 162
SspMI CTAG 1 cut(s) 196
TaaI ACNGT 1 cut(s) 22
TaqI TCGA 1 cut(s) 48
TasI AATT 1 cut(s) 162
TscAI CASTG 1 cut(s) 27
TspRI CASTG 1 cut(s) 27
XapI RAATTY 1 cut(s) 162
XcmI CCANNNNNNNNNTGG 1 cut(s) 151
XspI CTAG 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.