Rmu_sc0000147.1_g000017

Belongs to the CRISP family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000147.1
OG0001302
Physical Location & Seq
Reverse (-)
38220 .. 38705
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000147.1_g000017.1.cds

Sequence Viewer

Length: 486 bp
atggaattgtctaagatttcattatccctcatttccctcgtagccttcgccctactccattccactcatgcgcaaaactcaccccaggactacctcaatgcccacaatagtgctcgagccgccgttggcgtggcaggcttgacctgggacactaatctagctacttatgcgcaaagatatgctaattcacatattggtgattgcaacctggtgcattctggtgggccttacggcgaaaaccttgcaatgagcaccggcgacttatcaggcacatctgctgtgaacttgtgggtgggagagaaggcaaactataattacaactctaacacatgtgcttctggcaaggtttgtgggcattatacgcaggtcgtttggcgcaactcggcacgtgtggggtgtgccaaagtgaggtgcaacaatggaggtactttcatcgggtgcaattatgatccccggggaaacatcattggtcagaagccttactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04016 ko04075 ko04626 map04016 map04075 map04626
Pfam Domains
Protein Families
CAP

Protein Analysis

161

Amino Acids

17.19

Weight (kDa)

8.55

Isoelectric Point (pI)

20.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 2 cut(s) 72, 171
Acc36I ACCTGC 1 cut(s) 355
AciI CCGC 1 cut(s) 120
AclWI GGATC 1 cut(s) 443
AcvI CACGTG 1 cut(s) 389
AfaI GTAC 1 cut(s) 427
AfiI CCNNNNNNNGG 1 cut(s) 408
AflIII ACRYGT 2 cut(s) 329, 388
AjnI CCWGG 3 cut(s) 84, 143, 207
AleI CACNNNNGTG 1 cut(s) 108
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
Alw21I GWGCWC 2 cut(s) 115, 254
AlwI GGATC 1 cut(s) 443
Ama87I CYCGRG 2 cut(s) 114, 453
AoxI GGCC 1 cut(s) 224
AspLEI GCGC 3 cut(s) 73, 172, 378
AspS9I GGNCC 1 cut(s) 224
AsuC2I CCSGG 2 cut(s) 454, 455
AsuHPI GGTGA 2 cut(s) 72, 209
AvaI CYCGRG 2 cut(s) 114, 453
BbrPI CACGTG 1 cut(s) 389
Bbv12I GWGCWC 2 cut(s) 115, 254
BceAI ACGGC 2 cut(s) 107, 247
BcgI CGANNNNNNTGC 2 cut(s) 224, 258
BciT130I CCWGG 3 cut(s) 86, 145, 209
BcnI CCSGG 2 cut(s) 454, 455
BfaI CTAG 1 cut(s) 158
BfuAI ACCTGC 1 cut(s) 355
BisI GCNGC 1 cut(s) 120
BlsI GCNGC 1 cut(s) 121
Bme1390I CCNGG 5 cut(s) 86, 145, 209, 454, 455
BmeT110I CYCGRG 2 cut(s) 114, 453
BmgT120I GGNCC 1 cut(s) 224
BmrFI CCNGG 5 cut(s) 86, 145, 209, 454, 455
BpuMI CCSGG 2 cut(s) 454, 455
BsaAI YACGTR 1 cut(s) 389
BsaJI CCNNGG 5 cut(s) 84, 144, 452, 453, 454
Bsc4I CCNNNNNNNGG 1 cut(s) 408
Bse118I RCCGGY 1 cut(s) 254
Bse3DI GCAATG 1 cut(s) 252
BseBI CCWGG 3 cut(s) 86, 145, 209
BseDI CCNNGG 5 cut(s) 84, 144, 452, 453, 454
BseLI CCNNNNNNNGG 1 cut(s) 408
BseMI GCAATG 1 cut(s) 252
BshFI GGCC 1 cut(s) 226
BsiHKAI GWGCWC 2 cut(s) 115, 254
BsiHKCI CYCGRG 2 cut(s) 114, 453
BsiSI CCGG 2 cut(s) 255, 454
BslFI GGGAC 1 cut(s) 161
BslI CCNNNNNNNGG 1 cut(s) 408
BsmFI GGGAC 1 cut(s) 161
BsmI GAATGC 1 cut(s) 214
BsnI GGCC 1 cut(s) 226
BsoBI CYCGRG 2 cut(s) 114, 453
Bsp1286I GDGCHC 2 cut(s) 115, 254
Bsp143I GATC 1 cut(s) 448
BspACI CCGC 1 cut(s) 120
BspANI GGCC 1 cut(s) 226
BspMI ACCTGC 1 cut(s) 355
BspPI GGATC 1 cut(s) 443
BsrDI GCAATG 1 cut(s) 252
BsrFI RCCGGY 1 cut(s) 254
BssAI RCCGGY 1 cut(s) 254
BssECI CCNNGG 5 cut(s) 84, 144, 452, 453, 454
BssMI GATC 1 cut(s) 448
Bst2UI CCWGG 3 cut(s) 86, 145, 209
BstBAI YACGTR 1 cut(s) 389
BstC8I GCNNGC 1 cut(s) 136
BstDEI CTNAG 1 cut(s) 12
BstHHI GCGC 3 cut(s) 73, 172, 378
BstKTI GATC 1 cut(s) 451
BstMBI GATC 1 cut(s) 448
BstMWI GCNNNNNNNGC 4 cut(s) 119, 135, 167, 361
BstNI CCWGG 3 cut(s) 86, 145, 209
BstNSI RCATGY 1 cut(s) 333
BstSCI CCNGG 5 cut(s) 84, 143, 207, 452, 453
BsuRI GGCC 1 cut(s) 226
BveI ACCTGC 1 cut(s) 355
Cac8I GCNNGC 1 cut(s) 136
CfoI GCGC 3 cut(s) 73, 172, 378
Cfr10I RCCGGY 1 cut(s) 254
Cfr13I GGNCC 1 cut(s) 224
Cfr9I CCCGGG 1 cut(s) 453
CsiI ACCWGGT 1 cut(s) 207
Csp6I GTAC 1 cut(s) 426
CspCI CAANNNNNGTGG 2 cut(s) 331, 366
CviAII CATG 2 cut(s) 68, 330
CviJI RGCY 6 cut(s) 44, 119, 138, 161, 226, 478
CviKI_1 RGCY 6 cut(s) 44, 119, 138, 161, 226, 478
CviQI GTAC 1 cut(s) 426
DdeI CTNAG 1 cut(s) 12
DpnI GATC 1 cut(s) 450
DpnII GATC 1 cut(s) 448
Eco72I CACGTG 1 cut(s) 389
Eco88I CYCGRG 2 cut(s) 114, 453
EcoRII CCWGG 3 cut(s) 84, 143, 207
FaeI CATG 2 cut(s) 71, 333
FaiI YATR 8 cut(s) 69, 168, 180, 192, 312, 331, 360, 447
FaqI GGGAC 1 cut(s) 161
FatI CATG 2 cut(s) 67, 329
Fnu4HI GCNGC 1 cut(s) 120
Fsp4HI GCNGC 1 cut(s) 120
FspBI CTAG 1 cut(s) 158
FspI TGCGCA 2 cut(s) 72, 171
GlaI GCGC 3 cut(s) 72, 171, 377
GluI GCNGC 1 cut(s) 120
HaeIII GGCC 1 cut(s) 226
HapII CCGG 2 cut(s) 255, 454
HhaI GCGC 3 cut(s) 73, 172, 378
Hin1II CATG 2 cut(s) 71, 333
Hin6I GCGC 3 cut(s) 71, 170, 376
HinP1I GCGC 3 cut(s) 71, 170, 376
HpaII CCGG 2 cut(s) 255, 454
HphI GGTGA 2 cut(s) 72, 209
Hpy166II GTNNAC 1 cut(s) 283
Hpy188I TCNGA 1 cut(s) 474
Hpy8I GTNNAC 1 cut(s) 283
HpyAV CCTTC 2 cut(s) 55, 295
HpyCH4IV ACGT 1 cut(s) 388
HpyCH4V TGCA 5 cut(s) 204, 214, 245, 414, 441
HpyF10VI GCNNNNNNNGC 4 cut(s) 119, 135, 167, 361
HpyF3I CTNAG 1 cut(s) 12
HpySE526I ACGT 1 cut(s) 388
Hsp92II CATG 2 cut(s) 71, 333
HspAI GCGC 3 cut(s) 71, 170, 376
Kzo9I GATC 1 cut(s) 448
MabI ACCWGGT 1 cut(s) 207
MaeI CTAG 1 cut(s) 158
MaeII ACGT 1 cut(s) 388
MalI GATC 1 cut(s) 450
MboI GATC 1 cut(s) 448
MhlI GDGCHC 2 cut(s) 115, 254
MluCI AATT 4 cut(s) 5, 184, 313, 442
MnlI CCTC 5 cut(s) 38, 47, 104, 402, 416
MslI CAYNNNNRTG 3 cut(s) 108, 195, 219
MspI CCGG 2 cut(s) 255, 454
MspR9I CCNGG 5 cut(s) 86, 145, 209, 454, 455
Mva1269I GAATGC 1 cut(s) 214
MvaI CCWGG 3 cut(s) 86, 145, 209
MwoI GCNNNNNNNGC 4 cut(s) 119, 135, 167, 361
NciI CCSGG 2 cut(s) 454, 455
NdeII GATC 1 cut(s) 448
NlaIII CATG 2 cut(s) 71, 333
NmeAIII GCCGAG 1 cut(s) 362
NsbI TGCGCA 2 cut(s) 72, 171
NspI RCATGY 1 cut(s) 333
OliI CACNNNNGTG 1 cut(s) 108
PaeR7I CTCGAG 1 cut(s) 114
PciI ACATGT 1 cut(s) 329
PctI GAATGC 1 cut(s) 214
PkrI GCNGC 1 cut(s) 121
PmaCI CACGTG 1 cut(s) 389
PmlI CACGTG 1 cut(s) 389
Ppu21I YACGTR 1 cut(s) 389
PscI ACATGT 1 cut(s) 329
Psp6I CCWGG 3 cut(s) 84, 143, 207
PspCI CACGTG 1 cut(s) 389
PspGI CCWGG 3 cut(s) 84, 143, 207
PspPI GGNCC 1 cut(s) 224
PspXI VCTCGAGB 1 cut(s) 114
RsaI GTAC 1 cut(s) 427
RsaNI GTAC 1 cut(s) 426
RseI CAYNNNNRTG 3 cut(s) 108, 195, 219
SatI GCNGC 1 cut(s) 120
Sau3AI GATC 1 cut(s) 448
Sau96I GGNCC 1 cut(s) 224
ScrFI CCNGG 5 cut(s) 86, 145, 209, 454, 455
SduI GDGCHC 2 cut(s) 115, 254
SexAI ACCWGGT 1 cut(s) 207
Sfr274I CTCGAG 1 cut(s) 114
SgrAI CRCCGGYG 1 cut(s) 254
SlaI CTCGAG 1 cut(s) 114
SmaI CCCGGG 1 cut(s) 455
SmiMI CAYNNNNRTG 3 cut(s) 108, 195, 219
SmlI CTYRAG 1 cut(s) 114
SmoI CTYRAG 1 cut(s) 114
Sse9I AATT 4 cut(s) 5, 184, 313, 442
SsiI CCGC 1 cut(s) 120
SspMI CTAG 1 cut(s) 158
StyD4I CCNGG 5 cut(s) 84, 143, 207, 452, 453
TaiI ACGT 1 cut(s) 391
TaqI TCGA 1 cut(s) 115
TasI AATT 4 cut(s) 5, 184, 313, 442
TauI GCSGC 1 cut(s) 122
TspDTI ATGAA 2 cut(s) 9, 421
TspMI CCCGGG 1 cut(s) 453
XceI RCATGY 1 cut(s) 333
XhoI CTCGAG 1 cut(s) 114
XmaI CCCGGG 1 cut(s) 453
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.