Rmu_sc0000164.1_g000007

28 kDa heat- and acid-stable phosphoprotein-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000164.1
Physical Location & Seq
Forward (+)
48534 .. 50523
1990 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000164.1_g000007.1.cds

Sequence Viewer

Length: 420 bp
atgcccgtgagcacttcgagtgaaattggtaagctccagaatcccttgaaagttgtgggaatcatagaaattgagaatcccaatctagtaaagccaaagaatgtgaaggctaaaaatgtcgatcttgagaaaacaactgaactttctaggcgtgaaggggaggagattgaaaaacaaaaggctcatgagcgatacatgaggttgcaggagcagggaaaaactgaacaagcaaagaaagatttagcattcaggtcaagtttgatgtttagcattaaggcaagcagcaaccccgaaacatctcaacaagcagccaacaacactgttccaaaattgagtcaaccaaggaaagcttctacggctatgttgatgttgggagtctgcaggaaattgcttatttgctatgttgatgttgattgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.57

Weight (kDa)

9.3

Isoelectric Point (pI)

55.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 49, 170
AjuI GAANNNNNNNTTGG 2 cut(s) 334, 366
AluBI AGCT 2 cut(s) 34, 350
AluI AGCT 2 cut(s) 34, 350
Alw21I GWGCWC 1 cut(s) 14
ApeKI GCWGC 2 cut(s) 282, 308
Bbv12I GWGCWC 1 cut(s) 14
BbvI GCAGC 2 cut(s) 294, 320
BceAI ACGGC 1 cut(s) 372
BfaI CTAG 2 cut(s) 86, 147
BfmI CTRYAG 1 cut(s) 379
BisI GCNGC 2 cut(s) 283, 309
BlsI GCNGC 2 cut(s) 284, 310
BpmI CTGGAG 1 cut(s) 20
BpuEI CTTGAG 1 cut(s) 146
BsaJI CCNNGG 1 cut(s) 341
BseDI CCNNGG 1 cut(s) 341
BseRI GAGGAG 1 cut(s) 176
BseXI GCAGC 2 cut(s) 294, 320
BsiHKAI GWGCWC 1 cut(s) 14
BsmI GAATGC 1 cut(s) 245
Bsp1286I GDGCHC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 121
BspHI TCATGA 1 cut(s) 184
BspMAI CTGCAG 1 cut(s) 383
BssECI CCNNGG 1 cut(s) 341
BssMI GATC 1 cut(s) 121
BssT1I CCWWGG 1 cut(s) 341
Bst4CI ACNGT 1 cut(s) 322
BstC8I GCNNGC 1 cut(s) 280
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstMWI GCNNNNNNNGC 1 cut(s) 356
BstSFI CTRYAG 1 cut(s) 379
BstV1I GCAGC 2 cut(s) 294, 320
BtsIMutI CAGTG 1 cut(s) 318
Cac8I GCNNGC 1 cut(s) 280
CciI TCATGA 1 cut(s) 184
CviAII CATG 2 cut(s) 185, 196
CviJI RGCY 7 cut(s) 34, 94, 110, 182, 311, 350, 359
CviKI_1 RGCY 7 cut(s) 34, 94, 110, 182, 311, 350, 359
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eco130I CCWWGG 1 cut(s) 341
EcoT14I CCWWGG 1 cut(s) 341
ErhI CCWWGG 1 cut(s) 341
FaeI CATG 2 cut(s) 188, 199
FaiI YATR 5 cut(s) 65, 186, 197, 362, 402
FalI AAGNNNNNCTT 2 cut(s) 334, 366
FatI CATG 2 cut(s) 184, 195
Fnu4HI GCNGC 2 cut(s) 283, 309
Fsp4HI GCNGC 2 cut(s) 283, 309
FspBI CTAG 2 cut(s) 86, 147
GluI GCNGC 2 cut(s) 283, 309
GsuI CTGGAG 1 cut(s) 20
Hin1II CATG 2 cut(s) 188, 199
HincII GTYRAC 1 cut(s) 338
HindII GTYRAC 1 cut(s) 338
HindIII AAGCTT 1 cut(s) 348
HinfI GANTC 5 cut(s) 40, 60, 76, 334, 375
Hpy166II GTNNAC 1 cut(s) 338
Hpy188III TCNNGA 3 cut(s) 37, 125, 185
Hpy8I GTNNAC 1 cut(s) 338
HpyAV CCTTC 2 cut(s) 100, 149
HpyCH4III ACNGT 1 cut(s) 322
HpyCH4V TGCA 2 cut(s) 205, 381
HpyF10VI GCNNNNNNNGC 1 cut(s) 356
Hsp92II CATG 2 cut(s) 188, 199
Kzo9I GATC 1 cut(s) 121
LmnI GCTCC 2 cut(s) 39, 208
LpnPI CCDG 5 cut(s) 50, 191, 197, 235, 367
Lsp1109I GCAGC 2 cut(s) 294, 320
MaeI CTAG 2 cut(s) 86, 147
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MhlI GDGCHC 1 cut(s) 14
MluCI AATT 4 cut(s) 24, 69, 329, 386
MlyI GAGTC 2 cut(s) 343, 384
MnlI CCTC 2 cut(s) 154, 192
MseI TTAA 1 cut(s) 273
Mva1269I GAATGC 1 cut(s) 245
MwoI GCNNNNNNNGC 1 cut(s) 356
NdeII GATC 1 cut(s) 121
NlaIII CATG 2 cut(s) 188, 199
PagI TCATGA 1 cut(s) 184
PctI GAATGC 1 cut(s) 245
PfeI GAWTC 3 cut(s) 40, 60, 76
PkrI GCNGC 2 cut(s) 284, 310
PleI GAGTC 2 cut(s) 342, 383
PpsI GAGTC 2 cut(s) 342, 383
PstI CTGCAG 1 cut(s) 383
SaqAI TTAA 1 cut(s) 273
SatI GCNGC 2 cut(s) 283, 309
Sau3AI GATC 1 cut(s) 121
SchI GAGTC 2 cut(s) 343, 384
SduI GDGCHC 1 cut(s) 14
SetI ASST 4 cut(s) 36, 203, 254, 352
SfcI CTRYAG 1 cut(s) 379
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 4 cut(s) 24, 69, 329, 386
SspMI CTAG 2 cut(s) 86, 147
StyI CCWWGG 1 cut(s) 341
TaaI ACNGT 1 cut(s) 322
TaqI TCGA 2 cut(s) 17, 120
TasI AATT 4 cut(s) 24, 69, 329, 386
TfiI GAWTC 3 cut(s) 40, 60, 76
Tru1I TTAA 1 cut(s) 273
Tru9I TTAA 1 cut(s) 273
TscAI CASTG 1 cut(s) 325
TseI GCWGC 2 cut(s) 282, 308
TspRI CASTG 1 cut(s) 325
XspI CTAG 2 cut(s) 86, 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.