Rorug01G0054200

28 kDa heat- and acid-stable

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
8915936 .. 8916256
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0054200.1

Sequence Viewer

Length: 321 bp
ATGTCAGTAGATCCCTTGTTCTTTTACATTCCAGTTGTTGATGAGAACAACAAGTGTCTTGGAATGGACAGAACATTAAGGAATACAGTTCTTGTGTTGCGATCACTTATGGATCTCGCTTTTACACTCCATATTATTGCACTAATTCATGATCGGATCGATATCCCCTCAAACTCTGATTCTGACCCGGAAAAACATATTTATGAACGCATACTTAGGATGATGAAGTGGTTGTCTAAAGATATCATAATTGACGTTATTGCTATACTTCCCATCCCACAGGTAAGAAGAAATTTTTTTGGTGTAAATTGTTATTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

12.39

Weight (kDa)

6.25

Isoelectric Point (pI)

54.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 5, 120, 164
AcsI RAATTY 1 cut(s) 292
AlwI GGATC 3 cut(s) 5, 120, 164
ApoI RAATTY 1 cut(s) 292
AsuC2I CCSGG 1 cut(s) 188
BccI CCATC 1 cut(s) 281
BcnI CCSGG 1 cut(s) 188
Bme1390I CCNGG 1 cut(s) 188
BmrFI CCNGG 1 cut(s) 188
BpuMI CCSGG 1 cut(s) 188
Bsa29I ATCGAT 1 cut(s) 159
BsaBI GATNNNNATC 1 cut(s) 161
Bse1I ACTGG 1 cut(s) 32
Bse8I GATNNNNATC 1 cut(s) 161
BseCI ATCGAT 1 cut(s) 159
BseGI GGATG 2 cut(s) 225, 273
BseJI GATNNNNATC 1 cut(s) 161
BseNI ACTGG 1 cut(s) 32
BshVI ATCGAT 1 cut(s) 159
BsiSI CCGG 1 cut(s) 188
Bsp143I GATC 5 cut(s) 10, 101, 112, 151, 156
BspDI ATCGAT 1 cut(s) 159
BspHI TCATGA 1 cut(s) 148
BspPI GGATC 3 cut(s) 5, 120, 164
BsrI ACTGG 1 cut(s) 32
BssMI GATC 5 cut(s) 10, 101, 112, 151, 156
Bst4CI ACNGT 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 215
BstF5I GGATG 2 cut(s) 225, 273
BstKTI GATC 5 cut(s) 13, 104, 115, 154, 159
BstMBI GATC 5 cut(s) 10, 101, 112, 151, 156
BstSCI CCNGG 1 cut(s) 186
BstX2I RGATCY 2 cut(s) 10, 112
BstYI RGATCY 2 cut(s) 10, 112
Bsu15I ATCGAT 1 cut(s) 159
BsuTUI ATCGAT 1 cut(s) 159
BtsCI GGATG 2 cut(s) 225, 273
CciI TCATGA 1 cut(s) 148
ClaI ATCGAT 1 cut(s) 159
CviAII CATG 1 cut(s) 149
DdeI CTNAG 1 cut(s) 215
DpnI GATC 5 cut(s) 12, 103, 114, 153, 158
DpnII GATC 5 cut(s) 10, 101, 112, 151, 156
Eco32I GATATC 2 cut(s) 163, 244
EcoRV GATATC 2 cut(s) 163, 244
FaeI CATG 1 cut(s) 152
FaiI YATR 8 cut(s) 110, 132, 150, 198, 204, 212, 248, 266
FatI CATG 1 cut(s) 148
FokI GGATG 2 cut(s) 232, 260
HapII CCGG 1 cut(s) 188
Hin1II CATG 1 cut(s) 152
HinfI GANTC 1 cut(s) 179
HpaII CCGG 1 cut(s) 188
Hpy188I TCNGA 3 cut(s) 156, 178, 184
Hpy188III TCNNGA 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4IV ACGT 1 cut(s) 255
HpyCH4V TGCA 1 cut(s) 140
HpyF3I CTNAG 1 cut(s) 215
HpySE526I ACGT 1 cut(s) 255
Hsp92II CATG 1 cut(s) 152
Kzo9I GATC 5 cut(s) 10, 101, 112, 151, 156
LpnPI CCDG 3 cut(s) 45, 201, 266
MaeII ACGT 1 cut(s) 255
MalI GATC 5 cut(s) 12, 103, 114, 153, 158
MboI GATC 5 cut(s) 10, 101, 112, 151, 156
MboII GAAGA 1 cut(s) 300
MflI RGATCY 2 cut(s) 10, 112
MluCI AATT 4 cut(s) 144, 249, 292, 307
MnlI CCTC 1 cut(s) 178
MseI TTAA 1 cut(s) 77
MslI CAYNNNNRTG 1 cut(s) 201
MspI CCGG 1 cut(s) 188
MspR9I CCNGG 1 cut(s) 188
NciI CCSGG 1 cut(s) 188
NdeII GATC 5 cut(s) 10, 101, 112, 151, 156
NlaIII CATG 1 cut(s) 152
PagI TCATGA 1 cut(s) 148
PfeI GAWTC 1 cut(s) 179
PsuI RGATCY 2 cut(s) 10, 112
RseI CAYNNNNRTG 1 cut(s) 201
SaqAI TTAA 1 cut(s) 77
Sau3AI GATC 5 cut(s) 10, 101, 112, 151, 156
ScrFI CCNGG 1 cut(s) 188
SetI ASST 2 cut(s) 258, 285
SmiMI CAYNNNNRTG 1 cut(s) 201
Sse9I AATT 4 cut(s) 144, 249, 292, 307
StyD4I CCNGG 1 cut(s) 186
TaaI ACNGT 1 cut(s) 88
TaiI ACGT 1 cut(s) 258
TaqI TCGA 1 cut(s) 159
TasI AATT 4 cut(s) 144, 249, 292, 307
TfiI GAWTC 1 cut(s) 179
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TspDTI ATGAA 3 cut(s) 137, 219, 239
XapI RAATTY 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.