Rh5BG223000

28 kDa heat- and acid-stable phosphoprotein-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
25837962 .. 25853499
15538 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG223000.1

Sequence Viewer

Length: 309 bp
ATGAAGCGGAAGGGTACTCAGGGAATCATAGAAATTGAGAATCCCAATCTAGTAAAGCCAAAGAATGTGAAGGCTAAAAATGTCGATCTTGAGAAAACAACTGAACTTTCTAGGCGTGAAAGGGAGGAGATTGAAAAACAAAAGGCTCATGAGCGATACATGAGGTTGCAGGAGCAGGGAAAAACTGAACAAGCAAAGAAAGATTTAGAACGTTTAGCCATGATTCGCCAACAAAGGGCAGAGGCTGCTAAGAAGCGAGAAGAGGAGAAGGCTGCCAAGGAACAGAAAAAAGGCGAGGGACGCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

12.05

Weight (kDa)

9.91

Isoelectric Point (pI)

64.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP28 PF10252 14 - 91 1.3e-29 Casein kinase substrate phosphoprotein PP28
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 7
AclI AACGTT 1 cut(s) 211
AfaI GTAC 1 cut(s) 16
AfiI CCNNNNNNNGG 1 cut(s) 235
AgsI TTSAA 1 cut(s) 134
AlwNI CAGNNNCTG 1 cut(s) 245
ApeKI GCWGC 2 cut(s) 245, 272
BbvI GCAGC 2 cut(s) 232, 259
BfaI CTAG 2 cut(s) 50, 111
BisI GCNGC 2 cut(s) 246, 273
BlsI GCNGC 2 cut(s) 247, 274
BpuEI CTTGAG 1 cut(s) 110
BsaJI CCNNGG 1 cut(s) 276
Bsc4I CCNNNNNNNGG 1 cut(s) 235
BseDI CCNNGG 1 cut(s) 276
BseLI CCNNNNNNNGG 1 cut(s) 235
BseMII CTCAG 1 cut(s) 32
BseRI GAGGAG 2 cut(s) 140, 278
BseXI GCAGC 2 cut(s) 232, 259
BslI CCNNNNNNNGG 1 cut(s) 235
Bsp143I GATC 1 cut(s) 85
BspACI CCGC 1 cut(s) 7
BspCNI CTCAG 1 cut(s) 31
BspHI TCATGA 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 276
BssMI GATC 1 cut(s) 85
BssT1I CCWWGG 1 cut(s) 276
Bst6I CTCTTC 1 cut(s) 255
BstAPI GCANNNNNTGC 1 cut(s) 245
BstDEI CTNAG 2 cut(s) 18, 249
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
BstMWI GCNNNNNNNGC 2 cut(s) 245, 300
BstV1I GCAGC 2 cut(s) 232, 259
CaiI CAGNNNCTG 1 cut(s) 245
CciI TCATGA 1 cut(s) 148
Csp6I GTAC 1 cut(s) 15
CviAII CATG 3 cut(s) 149, 160, 220
CviJI RGCY 6 cut(s) 58, 74, 146, 218, 245, 272
CviKI_1 RGCY 6 cut(s) 58, 74, 146, 218, 245, 272
CviQI GTAC 1 cut(s) 15
DdeI CTNAG 2 cut(s) 18, 249
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
Eam1104I CTCTTC 1 cut(s) 255
EarI CTCTTC 1 cut(s) 255
Eco130I CCWWGG 1 cut(s) 276
EcoT14I CCWWGG 1 cut(s) 276
ErhI CCWWGG 1 cut(s) 276
FaeI CATG 3 cut(s) 152, 163, 223
FaiI YATR 4 cut(s) 29, 150, 161, 221
FatI CATG 3 cut(s) 148, 159, 219
Fnu4HI GCNGC 2 cut(s) 246, 273
Fsp4HI GCNGC 2 cut(s) 246, 273
FspBI CTAG 2 cut(s) 50, 111
GluI GCNGC 2 cut(s) 246, 273
Hin1II CATG 3 cut(s) 152, 163, 223
HinfI GANTC 3 cut(s) 24, 40, 223
Hpy188III TCNNGA 2 cut(s) 89, 149
HpyAV CCTTC 3 cut(s) 4, 64, 262
HpyCH4IV ACGT 1 cut(s) 211
HpyCH4V TGCA 1 cut(s) 169
HpyF10VI GCNNNNNNNGC 2 cut(s) 245, 300
HpyF3I CTNAG 2 cut(s) 18, 249
HpySE526I ACGT 1 cut(s) 211
Hsp92II CATG 3 cut(s) 152, 163, 223
Kzo9I GATC 1 cut(s) 85
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 3 cut(s) 5, 155, 161
Lsp1109I GCAGC 2 cut(s) 232, 259
MaeI CTAG 2 cut(s) 50, 111
MaeII ACGT 1 cut(s) 211
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MboII GAAGA 1 cut(s) 272
MluCI AATT 1 cut(s) 33
MnlI CCTC 5 cut(s) 118, 156, 235, 256, 289
MwoI GCNNNNNNNGC 2 cut(s) 245, 300
NdeII GATC 1 cut(s) 85
NlaIII CATG 3 cut(s) 152, 163, 223
PagI TCATGA 1 cut(s) 148
PfeI GAWTC 3 cut(s) 24, 40, 223
PkrI GCNGC 2 cut(s) 247, 274
Psp1406I AACGTT 1 cut(s) 211
PstNI CAGNNNCTG 1 cut(s) 245
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
SatI GCNGC 2 cut(s) 246, 273
Sau3AI GATC 1 cut(s) 85
SetI ASST 2 cut(s) 167, 214
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 1 cut(s) 33
SsiI CCGC 1 cut(s) 7
SspMI CTAG 2 cut(s) 50, 111
StyI CCWWGG 1 cut(s) 276
TaiI ACGT 1 cut(s) 214
TaqI TCGA 1 cut(s) 84
TasI AATT 1 cut(s) 33
TfiI GAWTC 3 cut(s) 24, 40, 223
TseI GCWGC 2 cut(s) 245, 272
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 2 cut(s) 50, 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.