Rmu_sc0000693.1_g000069

sugar phosphate phosphate translocator

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000693.1
Physical Location & Seq
Forward (+)
348075 .. 348434
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000693.1_g000069.1.cds

Sequence Viewer

Length: 282 bp
atgaatgtggctggtgtggtgaaagactggctcttgattgccttttcttggtctgtgatcaaggacactgtgaccccaatcaatctagtgggttatggccttgcgtttttgggggttgcgtattacaatcactcgaaattgcaggctctgaaggccaaggaggcgcagaagaaggtgcttccagcggatgaggaggtgaataataagctgttggaggctgaagttattgattcagcagaggtgaaaagctgtggattgattaggttggaattgcagaggtga

Protein Analysis

93

Amino Acids

10.29

Weight (kDa)

6.56

Isoelectric Point (pI)

23.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 185
AcuI CTGAAG 2 cut(s) 170, 240
AfiI CCNNNNNNNGG 1 cut(s) 48
AluBI AGCT 2 cut(s) 208, 249
AluI AGCT 2 cut(s) 208, 249
AlwNI CAGNNNCTG 1 cut(s) 148
AoxI GGCC 2 cut(s) 97, 153
AspLEI GCGC 1 cut(s) 166
AsuHPI GGTGA 3 cut(s) 31, 208, 253
BclI TGATCA 1 cut(s) 57
BfaI CTAG 1 cut(s) 86
BglI GCCNNNNNGGC 1 cut(s) 161
BsaJI CCNNGG 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 48
Bse1I ACTGG 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 193
BseLI CCNNNNNNNGG 1 cut(s) 48
BseNI ACTGG 1 cut(s) 32
BseRI GAGGAG 1 cut(s) 206
BshFI GGCC 2 cut(s) 99, 155
BslI CCNNNNNNNGG 1 cut(s) 48
BsnI GGCC 2 cut(s) 99, 155
Bsp143I GATC 1 cut(s) 57
BspACI CCGC 1 cut(s) 185
BspANI GGCC 2 cut(s) 99, 155
BsrI ACTGG 1 cut(s) 32
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 156
Bst4CI ACNGT 1 cut(s) 70
BstC8I GCNNGC 1 cut(s) 144
BstF5I GGATG 1 cut(s) 193
BstHHI GCGC 1 cut(s) 166
BstKTI GATC 1 cut(s) 60
BstMBI GATC 1 cut(s) 57
BstMWI GCNNNNNNNGC 2 cut(s) 152, 161
BsuRI GGCC 2 cut(s) 99, 155
BtsCI GGATG 1 cut(s) 193
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 144
CaiI CAGNNNCTG 1 cut(s) 148
CfoI GCGC 1 cut(s) 166
CviJI RGCY 8 cut(s) 11, 31, 99, 146, 155, 208, 218, 249
CviKI_1 RGCY 8 cut(s) 11, 31, 99, 146, 155, 208, 218, 249
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
Eco130I CCWWGG 1 cut(s) 156
Eco57I CTGAAG 2 cut(s) 170, 240
EcoT14I CCWWGG 1 cut(s) 156
ErhI CCWWGG 1 cut(s) 156
FaiI YATR 1 cut(s) 96
FbaI TGATCA 1 cut(s) 57
FokI GGATG 1 cut(s) 200
FspBI CTAG 1 cut(s) 86
GlaI GCGC 1 cut(s) 165
HaeIII GGCC 2 cut(s) 99, 155
HhaI GCGC 1 cut(s) 166
Hin6I GCGC 1 cut(s) 164
HinP1I GCGC 1 cut(s) 164
HinfI GANTC 1 cut(s) 230
HphI GGTGA 3 cut(s) 31, 208, 253
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 1 cut(s) 34
HpyAV CCTTC 2 cut(s) 145, 166
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4V TGCA 2 cut(s) 142, 274
HpyF10VI GCNNNNNNNGC 2 cut(s) 152, 161
HspAI GCGC 1 cut(s) 164
Ksp22I TGATCA 1 cut(s) 57
Kzo9I GATC 1 cut(s) 57
LpnPI CCDG 3 cut(s) 13, 128, 195
MaeI CTAG 1 cut(s) 86
MaeIII GTNAC 1 cut(s) 70
MalI GATC 1 cut(s) 59
MboI GATC 1 cut(s) 57
MboII GAAGA 1 cut(s) 181
MluCI AATT 2 cut(s) 137, 269
MmeI TCCRAC 2 cut(s) 192, 246
MnlI CCTC 6 cut(s) 154, 184, 187, 208, 232, 270
MspA1I CMGCKG 1 cut(s) 185
MwoI GCNNNNNNNGC 2 cut(s) 152, 161
NdeII GATC 1 cut(s) 57
NmuCI GTSAC 1 cut(s) 70
PfeI GAWTC 1 cut(s) 230
PstNI CAGNNNCTG 1 cut(s) 148
Sau3AI GATC 1 cut(s) 57
SetI ASST 7 cut(s) 177, 198, 210, 243, 251, 266, 281
Sse9I AATT 2 cut(s) 137, 269
SsiI CCGC 1 cut(s) 185
SspMI CTAG 1 cut(s) 86
StyI CCWWGG 1 cut(s) 156
TaaI ACNGT 1 cut(s) 70
TaqI TCGA 1 cut(s) 134
TasI AATT 2 cut(s) 137, 269
TfiI GAWTC 1 cut(s) 230
TscAI CASTG 1 cut(s) 73
TseFI GTSAC 1 cut(s) 70
Tsp45I GTSAC 1 cut(s) 70
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 73
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.