Rmu_sc0001626.1_g000015

Pentatricopeptide repeat-containing protein At3g61520

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001626.1
Physical Location & Seq
Forward (+)
87891 .. 88169
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001626.1_g000015.1.cds

Sequence Viewer

Length: 279 bp
atgagtgagcttatggcgaagatggaagagatgggcattaagcccaatgttataacttttggtattcttgttaatcggttatgcaagtctaggagaatagatgctgccttggaagtgtttgaaaagatgaatggaggggtaaaaggggtttccgctgaaccagatgtgatcgtctataacactttgattgatggactttgcaaggtgggaaggcaggaagaaggattgcgtttgtggattccgatctgcctttttgtgatagaaaggagagatgagtag

Protein Analysis

92

Amino Acids

10.4

Weight (kDa)

5.53

Isoelectric Point (pI)

57.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 53
AciI CCGC 1 cut(s) 153
AgsI TTSAA 1 cut(s) 122
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
ApeKI GCWGC 1 cut(s) 104
BbvI GCAGC 1 cut(s) 91
BccI CCATC 3 cut(s) 16, 25, 185
BfaI CTAG 1 cut(s) 90
BisI GCNGC 1 cut(s) 105
BlsI GCNGC 1 cut(s) 106
BmsI GCATC 1 cut(s) 91
BsaBI GATNNNNATC 1 cut(s) 242
BsaJI CCNNGG 1 cut(s) 108
Bse8I GATNNNNATC 1 cut(s) 242
BseDI CCNNGG 1 cut(s) 108
BseJI GATNNNNATC 1 cut(s) 242
BseXI GCAGC 1 cut(s) 91
Bsp143I GATC 2 cut(s) 168, 243
BspACI CCGC 1 cut(s) 153
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 2 cut(s) 168, 243
BssT1I CCWWGG 1 cut(s) 108
Bst6I CTCTTC 1 cut(s) 21
BstKTI GATC 2 cut(s) 171, 246
BstMBI GATC 2 cut(s) 168, 243
BstV1I GCAGC 1 cut(s) 91
CviJI RGCY 2 cut(s) 10, 43
CviKI_1 RGCY 2 cut(s) 10, 43
DpnI GATC 2 cut(s) 170, 245
DpnII GATC 2 cut(s) 168, 243
Eam1104I CTCTTC 1 cut(s) 21
EarI CTCTTC 1 cut(s) 21
Eco130I CCWWGG 1 cut(s) 108
EcoT14I CCWWGG 1 cut(s) 108
ErhI CCWWGG 1 cut(s) 108
FaiI YATR 4 cut(s) 14, 53, 82, 177
Fnu4HI GCNGC 1 cut(s) 105
Fsp4HI GCNGC 1 cut(s) 105
FspBI CTAG 1 cut(s) 90
GluI GCNGC 1 cut(s) 105
HinfI GANTC 1 cut(s) 238
Hpy188I TCNGA 1 cut(s) 243
HpyAV CCTTC 2 cut(s) 204, 215
HpyCH4V TGCA 2 cut(s) 84, 201
Kzo9I GATC 2 cut(s) 168, 243
LpnPI CCDG 2 cut(s) 174, 200
Lsp1109I GCAGC 1 cut(s) 91
LweI GCATC 1 cut(s) 91
MaeI CTAG 1 cut(s) 90
MalI GATC 2 cut(s) 170, 245
MboI GATC 2 cut(s) 168, 243
MboII GAAGA 3 cut(s) 31, 38, 230
MnlI CCTC 1 cut(s) 128
MseI TTAA 2 cut(s) 39, 72
MspA1I CMGCKG 1 cut(s) 155
NdeII GATC 2 cut(s) 168, 243
PfeI GAWTC 1 cut(s) 238
PkrI GCNGC 1 cut(s) 106
PsiI TTATAA 1 cut(s) 53
SaqAI TTAA 2 cut(s) 39, 72
SatI GCNGC 1 cut(s) 105
Sau3AI GATC 2 cut(s) 168, 243
SetI ASST 2 cut(s) 12, 207
SfaNI GCATC 1 cut(s) 91
SgeI CNNG 7 cut(s) 80, 97, 102, 121, 173, 214, 227
SsiI CCGC 1 cut(s) 153
SspMI CTAG 1 cut(s) 90
StyI CCWWGG 1 cut(s) 108
TfiI GAWTC 1 cut(s) 238
Tru1I TTAA 2 cut(s) 39, 72
Tru9I TTAA 2 cut(s) 39, 72
TseI GCWGC 1 cut(s) 104
TspDTI ATGAA 1 cut(s) 143
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.