Rmu_sc0002885.1_g000007

This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002885.1
Physical Location & Seq
Forward (+)
45696 .. 50521
4826 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002885.1_g000007.1.cds

Sequence Viewer

Length: 867 bp
atgcgtggggtggtacagcaactccagatagttctaatgatggtggagaggcgggaagcggaacaggtggtggaggtgaaagatatgaatatggacaatcttctgtggatggaggattccaatttacctgttaagcatcagttgcatccatatcggtgttcttggtctggagaggagactacaacaccggctcacagaaggatgaatcactcaattgggttgccttataacccaagcaatgacttggagaccggtctgaaggaggatcatgttgagcgcatgaaccggtggacgcaagcgaaactatatctgaaagcattgcaccgattccgtcacacactagtcctgaaaaaggcagaagaaaagaagcaggcagcacggaaactacttagagcacatacccaagccctacgagctgcggctatcttcaaagaagttgcagatcaagtgaaagggtctggagattattttccaattgaaccagatgaacttgctcgtttgacgaggagtagtgatgttgatgctctgcagcaatatggggggaaggaaggcttggcagatttactgaaaacagatttagacaagggaattgatggggatgatttactaaagcggacaattaaatttggatcaaacatatatcctccaaaaacagcaatgagccactggaggagcgggaccttgggctcttcggcgatggcggagatgagatcgaagcagtggcgtcttggtagtgcaatgaagtccatggtcgcctccgtagcccaaaagccaccggagccgctcctctgcttcgatctcatctccgccatcgccgaagagcccaaggtcccgctcctctgttattgtggagatggtgaactgtag

Protein Analysis

288

Amino Acids

32.6

Weight (kDa)

8.25

Isoelectric Point (pI)

39.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 228
AccBSI CCGCTC 3 cut(s) 675, 784, 835
AciI CCGC 9 cut(s) 52, 59, 419, 613, 675, 701, 782, 807, 833
AclWI GGATC 2 cut(s) 273, 637
AcsI RAATTY 1 cut(s) 623
AcuI CTGAAG 1 cut(s) 278
AcyI GRCGYC 1 cut(s) 724
AfaI GTAC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 352
AgeI ACCGGT 2 cut(s) 251, 285
AgsI TTSAA 2 cut(s) 430, 479
AhlI ACTAGT 1 cut(s) 340
AjuI GAANNNNNNNTTGG 2 cut(s) 536, 568
AluBI AGCT 1 cut(s) 416
AluI AGCT 1 cut(s) 416
Alw21I GWGCWC 1 cut(s) 397
Alw26I GTCTC 2 cut(s) 170, 242
AlwI GGATC 2 cut(s) 273, 637
ApeKI GCWGC 3 cut(s) 374, 416, 529
ApoI RAATTY 1 cut(s) 623
AsiGI ACCGGT 2 cut(s) 251, 285
AspLEI GCGC 1 cut(s) 279
AspS9I GGNCC 2 cut(s) 678, 829
AsuHPI GGTGA 1 cut(s) 88
AvaII GGWCC 2 cut(s) 678, 829
BanII GRGCYC 2 cut(s) 689, 825
Bbv12I GWGCWC 1 cut(s) 397
BbvI GCAGC 3 cut(s) 386, 403, 541
BccI CCATC 6 cut(s) 34, 103, 587, 691, 818, 848
BcgI CGANNNNNNTGC 2 cut(s) 134, 168
BcoDI GTCTC 2 cut(s) 170, 242
BcuI ACTAGT 1 cut(s) 340
BfaI CTAG 1 cut(s) 341
BfmI CTRYAG 2 cut(s) 527, 863
BisI GCNGC 5 cut(s) 375, 417, 420, 530, 782
BlsI GCNGC 5 cut(s) 376, 418, 421, 531, 783
Bme18I GGWCC 2 cut(s) 678, 829
BmgT120I GGNCC 2 cut(s) 678, 829
BmiI GGNNCC 3 cut(s) 679, 780, 831
BmsI GCATC 3 cut(s) 145, 154, 511
BpmI CTGGAG 4 cut(s) 8, 189, 480, 688
BsaHI GRCGYC 1 cut(s) 724
BsaI GGTCTC 1 cut(s) 242
BsaJI CCNNGG 3 cut(s) 681, 747, 825
BsaWI WCCGGW 3 cut(s) 251, 285, 775
BsaXI ACNNNNNCTCC 2 cut(s) 6, 36
Bsc4I CCNNNNNNNGG 1 cut(s) 352
Bse118I RCCGGY 3 cut(s) 187, 251, 285
Bse1I ACTGG 1 cut(s) 671
Bse3DI GCAATG 4 cut(s) 244, 317, 663, 744
BseDI CCNNGG 3 cut(s) 681, 747, 825
BseGI GGATG 4 cut(s) 114, 145, 207, 604
BseLI CCNNNNNNNGG 1 cut(s) 352
BseMI GCAATG 4 cut(s) 244, 317, 663, 744
BseNI ACTGG 1 cut(s) 671
BseRI GAGGAG 5 cut(s) 188, 520, 685, 776, 827
BseXI GCAGC 3 cut(s) 386, 403, 541
BshTI ACCGGT 2 cut(s) 251, 285
BsiHKAI GWGCWC 1 cut(s) 397
BsiSI CCGG 4 cut(s) 188, 252, 286, 776
BslFI GGGAC 2 cut(s) 691, 815
BslI CCNNNNNNNGG 1 cut(s) 352
BsmAI GTCTC 2 cut(s) 170, 242
BsmFI GGGAC 2 cut(s) 691, 815
Bso31I GGTCTC 1 cut(s) 242
Bsp1286I GDGCHC 3 cut(s) 397, 689, 825
Bsp143I GATC 5 cut(s) 265, 442, 629, 710, 796
Bsp19I CCATGG 1 cut(s) 747
BspACI CCGC 9 cut(s) 52, 59, 419, 613, 675, 701, 782, 807, 833
BspLI GGNNCC 3 cut(s) 679, 780, 831
BspMAI CTGCAG 1 cut(s) 531
BspPI GGATC 2 cut(s) 273, 637
BspQI GCTCTTC 2 cut(s) 694, 813
BspTNI GGTCTC 1 cut(s) 242
BsrBI CCGCTC 3 cut(s) 675, 784, 835
BsrDI GCAATG 4 cut(s) 244, 317, 663, 744
BsrFI RCCGGY 3 cut(s) 187, 251, 285
BsrI ACTGG 1 cut(s) 671
BssAI RCCGGY 3 cut(s) 187, 251, 285
BssECI CCNNGG 3 cut(s) 681, 747, 825
BssMI GATC 5 cut(s) 265, 442, 629, 710, 796
BssNI GRCGYC 1 cut(s) 724
BssT1I CCWWGG 3 cut(s) 681, 747, 825
Bst4CI ACNGT 1 cut(s) 864
Bst6I CTCTTC 2 cut(s) 694, 813
BstACI GRCGYC 1 cut(s) 724
BstAPI GCANNNNNTGC 1 cut(s) 142
BstC8I GCNNGC 2 cut(s) 297, 372
BstDEI CTNAG 1 cut(s) 389
BstDSI CCRYGG 1 cut(s) 747
BstENI CCTNNNNNAGG 1 cut(s) 350
BstF5I GGATG 4 cut(s) 114, 145, 207, 604
BstHHI GCGC 1 cut(s) 279
BstKTI GATC 5 cut(s) 268, 445, 632, 713, 799
BstMAI GTCTC 2 cut(s) 170, 242
BstMBI GATC 5 cut(s) 265, 442, 629, 710, 796
BstMWI GCNNNNNNNGC 4 cut(s) 142, 413, 761, 778
BstSFI CTRYAG 2 cut(s) 527, 863
BstV1I GCAGC 3 cut(s) 386, 403, 541
BtgI CCRYGG 1 cut(s) 747
BtgZI GCGATG 2 cut(s) 710, 796
BtsCI GGATG 4 cut(s) 114, 145, 207, 604
BtsI GCAGTG 1 cut(s) 725
BtsIMutI CAGTG 2 cut(s) 664, 725
Cac8I GCNNGC 2 cut(s) 297, 372
CfoI GCGC 1 cut(s) 279
Cfr10I RCCGGY 3 cut(s) 187, 251, 285
Cfr13I GGNCC 2 cut(s) 678, 829
CseI GACGC 2 cut(s) 301, 713
Csp6I GTAC 1 cut(s) 14
CspAI ACCGGT 2 cut(s) 251, 285
CviAII CATG 3 cut(s) 269, 280, 748
CviQI GTAC 1 cut(s) 14
DdeI CTNAG 1 cut(s) 389
DpnI GATC 5 cut(s) 267, 444, 631, 712, 798
DpnII GATC 5 cut(s) 265, 442, 629, 710, 796
Eam1104I CTCTTC 2 cut(s) 694, 813
EarI CTCTTC 2 cut(s) 694, 813
EciI GGCGGA 2 cut(s) 716, 796
Eco130I CCWWGG 3 cut(s) 681, 747, 825
Eco24I GRGCYC 2 cut(s) 689, 825
Eco31I GGTCTC 1 cut(s) 242
Eco47I GGWCC 2 cut(s) 678, 829
Eco57I CTGAAG 1 cut(s) 278
EcoNI CCTNNNNNAGG 1 cut(s) 350
EcoO109I RGGNCCY 2 cut(s) 678, 829
EcoT14I CCWWGG 3 cut(s) 681, 747, 825
EcoT38I GRGCYC 2 cut(s) 689, 825
ErhI CCWWGG 3 cut(s) 681, 747, 825
FaeI CATG 3 cut(s) 272, 283, 751
FalI AAGNNNNNCTT 2 cut(s) 536, 568
FaqI GGGAC 2 cut(s) 691, 815
FatI CATG 3 cut(s) 268, 279, 747
FauI CCCGC 3 cut(s) 45, 668, 840
Fnu4HI GCNGC 5 cut(s) 375, 417, 420, 530, 782
FokI GGATG 4 cut(s) 121, 132, 214, 611
FriOI GRGCYC 2 cut(s) 689, 825
Fsp4HI GCNGC 5 cut(s) 375, 417, 420, 530, 782
FspBI CTAG 1 cut(s) 341
GlaI GCGC 1 cut(s) 278
GluI GCNGC 5 cut(s) 375, 417, 420, 530, 782
GsuI CTGGAG 4 cut(s) 8, 189, 480, 688
HapII CCGG 4 cut(s) 188, 252, 286, 776
HgaI GACGC 2 cut(s) 301, 713
HhaI GCGC 1 cut(s) 279
Hin1I GRCGYC 1 cut(s) 724
Hin1II CATG 3 cut(s) 272, 283, 751
Hin6I GCGC 1 cut(s) 277
HinP1I GCGC 1 cut(s) 277
HinfI GANTC 3 cut(s) 116, 205, 327
HpaII CCGG 4 cut(s) 188, 252, 286, 776
HphI GGTGA 1 cut(s) 88
Hpy166II GTNNAC 2 cut(s) 291, 860
Hpy188I TCNGA 2 cut(s) 258, 312
Hpy188III TCNNGA 4 cut(s) 25, 168, 346, 459
Hpy8I GTNNAC 2 cut(s) 291, 860
HpyAV CCTTC 4 cut(s) 192, 253, 538, 542
HpyCH4III ACNGT 1 cut(s) 864
HpyCH4V TGCA 5 cut(s) 145, 322, 440, 529, 737
HpyF10VI GCNNNNNNNGC 4 cut(s) 142, 413, 761, 778
HpyF3I CTNAG 1 cut(s) 389
Hsp92I GRCGYC 1 cut(s) 724
Hsp92II CATG 3 cut(s) 272, 283, 751
HspAI GCGC 1 cut(s) 277
Kzo9I GATC 5 cut(s) 265, 442, 629, 710, 796
LguI GCTCTTC 2 cut(s) 694, 813
LmnI GCTCC 4 cut(s) 672, 778, 789, 840
Lsp1109I GCAGC 3 cut(s) 386, 403, 541
LweI GCATC 3 cut(s) 145, 154, 511
MaeI CTAG 1 cut(s) 341
MaeIII GTNAC 1 cut(s) 332
MalI GATC 5 cut(s) 267, 444, 631, 712, 798
MbiI CCGCTC 3 cut(s) 675, 784, 835
MboI GATC 5 cut(s) 265, 442, 629, 710, 796
MboII GAAGA 5 cut(s) 92, 371, 418, 681, 830
MfeI CAATTG 2 cut(s) 213, 474
MhlI GDGCHC 3 cut(s) 397, 689, 825
MluCI AATT 6 cut(s) 121, 213, 474, 588, 618, 623
MseI TTAA 2 cut(s) 132, 621
MslI CAYNNNNRTG 1 cut(s) 154
MspI CCGG 4 cut(s) 188, 252, 286, 776
MunI CAATTG 2 cut(s) 213, 474
MwoI GCNNNNNNNGC 4 cut(s) 142, 413, 761, 778
NcoI CCATGG 1 cut(s) 747
NdeII GATC 5 cut(s) 265, 442, 629, 710, 796
NlaIII CATG 3 cut(s) 272, 283, 751
NlaIV GGNNCC 3 cut(s) 679, 780, 831
NmuCI GTSAC 1 cut(s) 332
PciSI GCTCTTC 2 cut(s) 694, 813
PfeI GAWTC 3 cut(s) 116, 205, 327
PinAI ACCGGT 2 cut(s) 251, 285
PkrI GCNGC 5 cut(s) 376, 418, 421, 531, 783
PpuMI RGGWCCY 2 cut(s) 678, 829
PsiI TTATAA 1 cut(s) 228
Psp5II RGGWCCY 2 cut(s) 678, 829
PspN4I GGNNCC 3 cut(s) 679, 780, 831
PspPI GGNCC 2 cut(s) 678, 829
PspPPI RGGWCCY 2 cut(s) 678, 829
PstI CTGCAG 1 cut(s) 531
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
RseI CAYNNNNRTG 1 cut(s) 154
SapI GCTCTTC 2 cut(s) 694, 813
SaqAI TTAA 2 cut(s) 132, 621
SatI GCNGC 5 cut(s) 375, 417, 420, 530, 782
Sau3AI GATC 5 cut(s) 265, 442, 629, 710, 796
Sau96I GGNCC 2 cut(s) 678, 829
SduI GDGCHC 3 cut(s) 397, 689, 825
SetI ASST 6 cut(s) 69, 78, 130, 418, 683, 831
SfaNI GCATC 3 cut(s) 145, 154, 511
SfcI CTRYAG 2 cut(s) 527, 863
SinI GGWCC 2 cut(s) 678, 829
SmiMI CAYNNNNRTG 1 cut(s) 154
SpeI ACTAGT 1 cut(s) 340
Sse9I AATT 6 cut(s) 121, 213, 474, 588, 618, 623
SsiI CCGC 9 cut(s) 52, 59, 419, 613, 675, 701, 782, 807, 833
SspMI CTAG 1 cut(s) 341
StyI CCWWGG 3 cut(s) 681, 747, 825
TaaI ACNGT 1 cut(s) 864
TaqI TCGA 2 cut(s) 713, 795
TasI AATT 6 cut(s) 121, 213, 474, 588, 618, 623
TauI GCSGC 2 cut(s) 422, 784
TfiI GAWTC 3 cut(s) 116, 205, 327
Tru1I TTAA 2 cut(s) 132, 621
Tru9I TTAA 2 cut(s) 132, 621
TscAI CASTG 2 cut(s) 671, 725
TseFI GTSAC 1 cut(s) 332
TseI GCWGC 3 cut(s) 374, 416, 529
Tsp45I GTSAC 1 cut(s) 332
TspDTI ATGAA 5 cut(s) 101, 218, 296, 501, 755
TspGWI ACGGA 3 cut(s) 320, 394, 748
TspRI CASTG 2 cut(s) 671, 725
VpaK11BI GGWCC 2 cut(s) 678, 829
XagI CCTNNNNNAGG 1 cut(s) 350
XapI RAATTY 1 cut(s) 623
XspI CTAG 1 cut(s) 341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.