Rmu_sc0003801.1_g000001

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003801.1
Physical Location & Seq
Reverse (-)
13809 .. 14890
1082 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003801.1_g000001.1.cds

Sequence Viewer

Length: 357 bp
atgtgtttagatgcatctttggaggaagaggtattggtatgtggagatatacgtggaaatcttgttttgttccctttgttgaagagtgtgttgctgggctcattggttgcatctgatgttaaaatatctccatcaagttgtttcagaggagctcatgggatatcaagcatctccagtgttgctgttgctagactaagttctaatcagattgaaatatgcttgactggagcagatgggtgtatatgctatctggaatatgacaaagataggaatgatttggaatttatagggatgaaacaagtgaaggagttgggtcttattcaatctgtctctacatgcaatagctctatgaactaa

Protein Analysis

118

Amino Acids

12.61

Weight (kDa)

4.67

Isoelectric Point (pI)

38.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 281
AgsI TTSAA 3 cut(s) 82, 212, 323
AluBI AGCT 2 cut(s) 152, 345
AluI AGCT 2 cut(s) 152, 345
Alw21I GWGCWC 1 cut(s) 154
Alw26I GTCTC 1 cut(s) 334
ApoI RAATTY 1 cut(s) 281
BanII GRGCYC 2 cut(s) 101, 154
Bbv12I GWGCWC 1 cut(s) 154
BccI CCATC 2 cut(s) 139, 227
BcoDI GTCTC 1 cut(s) 334
BfaI CTAG 1 cut(s) 189
BmsI GCATC 3 cut(s) 23, 119, 177
BpmI CTGGAG 2 cut(s) 157, 246
BsaAI YACGTR 1 cut(s) 53
Bse1I ACTGG 2 cut(s) 174, 229
BseGI GGATG 1 cut(s) 297
BseNI ACTGG 2 cut(s) 174, 229
BseRI GAGGAG 1 cut(s) 162
BseYI CCCAGC 1 cut(s) 94
BsiHKAI GWGCWC 1 cut(s) 154
BsmAI GTCTC 1 cut(s) 334
Bsp1286I GDGCHC 2 cut(s) 101, 154
BsrI ACTGG 2 cut(s) 174, 229
Bst6I CTCTTC 2 cut(s) 21, 77
BstBAI YACGTR 1 cut(s) 53
BstDEI CTNAG 1 cut(s) 194
BstF5I GGATG 1 cut(s) 297
BstMAI GTCTC 1 cut(s) 334
BstNSI RCATGY 1 cut(s) 339
BtsCI GGATG 1 cut(s) 297
BtsIMutI CAGTG 1 cut(s) 181
CviAII CATG 2 cut(s) 155, 336
CviJI RGCY 3 cut(s) 99, 152, 345
CviKI_1 RGCY 3 cut(s) 99, 152, 345
DdeI CTNAG 1 cut(s) 194
Eam1104I CTCTTC 2 cut(s) 21, 77
EarI CTCTTC 2 cut(s) 21, 77
Ecl136II GAGCTC 1 cut(s) 152
Eco24I GRGCYC 2 cut(s) 101, 154
Eco32I GATATC 1 cut(s) 162
Eco53kI GAGCTC 1 cut(s) 152
EcoICRI GAGCTC 1 cut(s) 152
EcoRV GATATC 1 cut(s) 162
EcoT22I ATGCAT 1 cut(s) 16
EcoT38I GRGCYC 2 cut(s) 101, 154
FaeI CATG 2 cut(s) 158, 339
FatI CATG 2 cut(s) 154, 335
FokI GGATG 1 cut(s) 304
FriOI GRGCYC 2 cut(s) 101, 154
FspBI CTAG 1 cut(s) 189
GsaI CCCAGC 1 cut(s) 98
GsuI CTGGAG 2 cut(s) 157, 246
Hin1II CATG 2 cut(s) 158, 339
Hpy188I TCNGA 3 cut(s) 115, 146, 207
Hpy188III TCNNGA 1 cut(s) 251
HpyAV CCTTC 1 cut(s) 298
HpyCH4IV ACGT 1 cut(s) 52
HpyCH4V TGCA 3 cut(s) 14, 110, 339
HpyF3I CTNAG 1 cut(s) 194
HpySE526I ACGT 1 cut(s) 52
Hsp92II CATG 2 cut(s) 158, 339
LmnI GCTCC 2 cut(s) 149, 227
LpnPI CCDG 4 cut(s) 80, 187, 210, 236
LweI GCATC 3 cut(s) 23, 119, 177
MaeI CTAG 1 cut(s) 189
MaeII ACGT 1 cut(s) 52
MboII GAAGA 2 cut(s) 38, 94
MhlI GDGCHC 2 cut(s) 101, 154
MluCI AATT 1 cut(s) 281
MnlI CCTC 3 cut(s) 16, 22, 140
Mph1103I ATGCAT 1 cut(s) 16
MseI TTAA 1 cut(s) 120
NlaIII CATG 2 cut(s) 158, 339
NsiI ATGCAT 1 cut(s) 16
NspI RCATGY 1 cut(s) 339
Ppu21I YACGTR 1 cut(s) 53
Psp124BI GAGCTC 1 cut(s) 154
PspFI CCCAGC 1 cut(s) 94
SacI GAGCTC 1 cut(s) 154
SaqAI TTAA 1 cut(s) 120
SduI GDGCHC 2 cut(s) 101, 154
SetI ASST 4 cut(s) 33, 55, 154, 347
SfaNI GCATC 3 cut(s) 23, 119, 177
Sse9I AATT 1 cut(s) 281
SspMI CTAG 1 cut(s) 189
SstI GAGCTC 1 cut(s) 154
TaiI ACGT 1 cut(s) 55
TasI AATT 1 cut(s) 281
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TscAI CASTG 1 cut(s) 181
TspDTI ATGAA 1 cut(s) 308
TspRI CASTG 1 cut(s) 181
XapI RAATTY 1 cut(s) 281
XceI RCATGY 1 cut(s) 339
XspI CTAG 1 cut(s) 189
Zsp2I ATGCAT 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.