Rmu_sc0005197.1_g000015

acyltransferase-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005197.1
Physical Location & Seq
Forward (+)
54771 .. 55368
598 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005197.1_g000015.1.cds

Sequence Viewer

Length: 366 bp
atgaaagctcctttcctcaagaaatatgtagaagaaaaatcagatgaagctggaaaactgagggctaccattgatggggaagtaggaaaccaagctgtacactacccaggaattctaccgaaatttcctggctggttttattattgttttgggaaaccaattgaaacagaagggaggaaccaggaattacgagacagggagaaggctcaggaattgtatttacaagtgaaatcagaggttgagaactgcattgcttatttgcagaaaaaaaaagagagtgatccttacagaagccttgcatctcggctactcttccaggcaaaacatggctttacagctcaagttcctgcatttgacatcgattaa

Protein Analysis

121

Amino Acids

13.95

Weight (kDa)

7.72

Isoelectric Point (pI)

48.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 275
AcsI RAATTY 2 cut(s) 111, 122
AfaI GTAC 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 75
AgsI TTSAA 1 cut(s) 164
AjnI CCWGG 4 cut(s) 106, 127, 180, 315
AluBI AGCT 4 cut(s) 8, 50, 95, 338
AluI AGCT 4 cut(s) 8, 50, 95, 338
Alw26I GTCTC 1 cut(s) 186
AlwI GGATC 1 cut(s) 275
ApoI RAATTY 2 cut(s) 111, 122
BccI CCATC 1 cut(s) 68
BciT130I CCWGG 4 cut(s) 108, 129, 182, 317
BcoDI GTCTC 1 cut(s) 186
Bme1390I CCNGG 4 cut(s) 108, 129, 182, 317
BmiI GGNNCC 1 cut(s) 179
BmrFI CCNGG 4 cut(s) 108, 129, 182, 317
BmsI GCATC 1 cut(s) 308
Bpu10I CCTNAGC 1 cut(s) 207
BpuEI CTTGAG 1 cut(s) 324
Bsa29I ATCGAT 1 cut(s) 360
BsaJI CCNNGG 1 cut(s) 106
Bsc4I CCNNNNNNNGG 1 cut(s) 75
Bse3DI GCAATG 1 cut(s) 249
BseBI CCWGG 4 cut(s) 108, 129, 182, 317
BseCI ATCGAT 1 cut(s) 360
BseDI CCNNGG 1 cut(s) 106
BseLI CCNNNNNNNGG 1 cut(s) 75
BseMI GCAATG 1 cut(s) 249
BseMII CTCAG 2 cut(s) 50, 221
BshVI ATCGAT 1 cut(s) 360
BslI CCNNNNNNNGG 1 cut(s) 75
BsmAI GTCTC 1 cut(s) 186
Bsp1407I TGTACA 1 cut(s) 97
Bsp143I GATC 1 cut(s) 280
BspCNI CTCAG 2 cut(s) 51, 220
BspDI ATCGAT 1 cut(s) 360
BspLI GGNNCC 1 cut(s) 179
BspPI GGATC 1 cut(s) 275
BsrDI GCAATG 1 cut(s) 249
BsrGI TGTACA 1 cut(s) 97
BssECI CCNNGG 1 cut(s) 106
BssMI GATC 1 cut(s) 280
Bst2UI CCWGG 4 cut(s) 108, 129, 182, 317
Bst6I CTCTTC 1 cut(s) 317
BstAUI TGTACA 1 cut(s) 97
BstDEI CTNAG 2 cut(s) 59, 207
BstKTI GATC 1 cut(s) 283
BstMAI GTCTC 1 cut(s) 186
BstMBI GATC 1 cut(s) 280
BstNI CCWGG 4 cut(s) 108, 129, 182, 317
BstSCI CCNGG 4 cut(s) 106, 127, 180, 315
Bsu15I ATCGAT 1 cut(s) 360
BsuTUI ATCGAT 1 cut(s) 360
ClaI ATCGAT 1 cut(s) 360
Csp6I GTAC 1 cut(s) 98
CviAII CATG 1 cut(s) 326
CviQI GTAC 1 cut(s) 98
DdeI CTNAG 2 cut(s) 59, 207
DpnI GATC 1 cut(s) 282
DpnII GATC 1 cut(s) 280
Eam1104I CTCTTC 1 cut(s) 317
EarI CTCTTC 1 cut(s) 317
EcoRI GAATTC 1 cut(s) 111
EcoRII CCWGG 4 cut(s) 106, 127, 180, 315
FaeI CATG 1 cut(s) 329
FaiI YATR 2 cut(s) 27, 327
FatI CATG 1 cut(s) 325
Hin1II CATG 1 cut(s) 329
Hpy166II GTNNAC 1 cut(s) 100
Hpy188I TCNGA 2 cut(s) 43, 235
Hpy188III TCNNGA 2 cut(s) 19, 209
Hpy8I GTNNAC 1 cut(s) 100
HpyAV CCTTC 2 cut(s) 164, 196
HpyCH4V TGCA 4 cut(s) 249, 262, 299, 350
HpyF3I CTNAG 2 cut(s) 59, 207
Hsp92II CATG 1 cut(s) 329
Kzo9I GATC 1 cut(s) 280
LmnI GCTCC 1 cut(s) 13
LweI GCATC 1 cut(s) 308
MalI GATC 1 cut(s) 282
MboI GATC 1 cut(s) 280
MboII GAAGA 2 cut(s) 44, 304
MfeI CAATTG 1 cut(s) 159
MluCI AATT 5 cut(s) 111, 122, 159, 185, 212
MnlI CCTC 4 cut(s) 26, 54, 168, 229
MseI TTAA 1 cut(s) 364
MspR9I CCNGG 4 cut(s) 108, 129, 182, 317
MunI CAATTG 1 cut(s) 159
MvaI CCWGG 4 cut(s) 108, 129, 182, 317
NdeII GATC 1 cut(s) 280
NlaIII CATG 1 cut(s) 329
NlaIV GGNNCC 1 cut(s) 179
NmeAIII GCCGAG 1 cut(s) 283
Psp6I CCWGG 4 cut(s) 106, 127, 180, 315
PspGI CCWGG 4 cut(s) 106, 127, 180, 315
PspN4I GGNNCC 1 cut(s) 179
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
SaqAI TTAA 1 cut(s) 364
Sau3AI GATC 1 cut(s) 280
ScrFI CCNGG 4 cut(s) 108, 129, 182, 317
SetI ASST 5 cut(s) 10, 52, 97, 240, 340
SfaNI GCATC 1 cut(s) 308
SmlI CTYRAG 2 cut(s) 17, 339
SmoI CTYRAG 2 cut(s) 17, 339
Sse9I AATT 5 cut(s) 111, 122, 159, 185, 212
StyD4I CCNGG 4 cut(s) 106, 127, 180, 315
TaqI TCGA 1 cut(s) 360
TasI AATT 5 cut(s) 111, 122, 159, 185, 212
TatI WGTACW 1 cut(s) 97
Tru1I TTAA 1 cut(s) 364
Tru9I TTAA 1 cut(s) 364
TspDTI ATGAA 2 cut(s) 17, 60
XapI RAATTY 2 cut(s) 111, 122
XcmI CCANNNNNNNNNTGG 1 cut(s) 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.