Rmu_sc0006274.1_g000005

Protein trichome birefringence-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006274.1
Physical Location & Seq
Forward (+)
6212 .. 8447
2236 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006274.1_g000005.1.cds

Sequence Viewer

Length: 651 bp
atgggtgcttctgagttttcatggaagatgggaaatcagagcagtactcaaatgggtactgaccaatcttcaaaacccatgatttcattgcctcaagaatccaatcagaccagaaatgagtcatcttttcctgagggttctaatggggaaaatggtttgccaagctatgtggcattgaagtccataagcaatgagggattgtctgggtttgagttgatgaatggttgtgatttgtttaatggaagatggaacctcttggatggtttacaactatacaccatcttcatatttgctttaccatttctcagcggtggaagatggaatactggaggtcaatgtcatggtcggacagagccaattcaatatgaggcatacaaaggaaaatatccggcaaagatgagaatactggactcagtaattagggaaatgaagactccaatcttttatctgaatgttacaaaaatgactgattttcggcgggatgctcatccatccatttacagaaagcagaatttgacggaggaggagagacagctgtctttgcgatcccaggattgcagtcattggtgcctccctggtgttcgtgatacatggaacgagcttctatgtgctcatctccttagatatatccagcatcggaggagaccatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

216

Amino Acids

24.78

Weight (kDa)

8.59

Isoelectric Point (pI)

59.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 567
AciI CCGC 2 cut(s) 309, 478
AclWI GGATC 1 cut(s) 540
AcsI RAATTY 1 cut(s) 511
AfaI GTAC 2 cut(s) 46, 58
AgsI TTSAA 3 cut(s) 72, 178, 362
AjnI CCWGG 2 cut(s) 549, 574
AluBI AGCT 3 cut(s) 165, 535, 601
AluI AGCT 3 cut(s) 165, 535, 601
Alw21I GWGCWC 1 cut(s) 613
Alw26I GTCTC 2 cut(s) 523, 637
AlwI GGATC 1 cut(s) 540
ApoI RAATTY 1 cut(s) 511
AxyI CCTNAGG 1 cut(s) 132
BanI GGYRCC 1 cut(s) 567
BarI GAAGNNNNNNTAC 2 cut(s) 307, 339
BbsI GAAGAC 1 cut(s) 437
Bbv12I GWGCWC 1 cut(s) 613
BccI CCATC 6 cut(s) 22, 240, 254, 287, 312, 499
BciT130I CCWGG 2 cut(s) 551, 576
BcoDI GTCTC 2 cut(s) 523, 637
BmcAI AGTACT 1 cut(s) 46
Bme1390I CCNGG 2 cut(s) 551, 576
BmiI GGNNCC 2 cut(s) 251, 569
BmrFI CCNGG 2 cut(s) 551, 576
BmsI GCATC 2 cut(s) 472, 643
BoxI GACNNNNGTC 1 cut(s) 535
BpiI GAAGAC 1 cut(s) 437
BplI GAGNNNNNCTC 2 cut(s) 31, 63
BpmI CTGGAG 1 cut(s) 348
BpuEI CTTGAG 1 cut(s) 78
BsaBI GATNNNNATC 1 cut(s) 486
BsaI GGTCTC 1 cut(s) 637
BsaJI CCNNGG 2 cut(s) 549, 574
Bse1I ACTGG 2 cut(s) 331, 411
Bse21I CCTNAGG 1 cut(s) 132
Bse3DI GCAATG 2 cut(s) 86, 196
Bse8I GATNNNNATC 1 cut(s) 486
BseBI CCWGG 2 cut(s) 551, 576
BseDI CCNNGG 2 cut(s) 549, 574
BseGI GGATG 4 cut(s) 265, 487, 487, 491
BseJI GATNNNNATC 1 cut(s) 486
BseMI GCAATG 2 cut(s) 86, 196
BseMII CTCAG 3 cut(s) 123, 319, 426
BseNI ACTGG 2 cut(s) 331, 411
BseRI GAGGAG 2 cut(s) 536, 539
BshNI GGYRCC 1 cut(s) 567
BsiHKAI GWGCWC 1 cut(s) 613
BsiSI CCGG 1 cut(s) 389
BsmAI GTCTC 2 cut(s) 523, 637
Bso31I GGTCTC 1 cut(s) 637
Bsp1286I GDGCHC 1 cut(s) 613
Bsp143I GATC 1 cut(s) 545
BspACI CCGC 2 cut(s) 309, 478
BspCNI CTCAG 4 cut(s) 4, 124, 318, 425
BspLI GGNNCC 2 cut(s) 251, 569
BspPI GGATC 1 cut(s) 540
BspT107I GGYRCC 1 cut(s) 567
BspTNI GGTCTC 1 cut(s) 637
BsrDI GCAATG 2 cut(s) 86, 196
BsrI ACTGG 2 cut(s) 331, 411
BssECI CCNNGG 2 cut(s) 549, 574
BssMI GATC 1 cut(s) 545
Bst2UI CCWGG 2 cut(s) 551, 576
BstDEI CTNAG 5 cut(s) 12, 132, 305, 412, 620
BstF5I GGATG 4 cut(s) 265, 487, 487, 491
BstKTI GATC 1 cut(s) 548
BstMAI GTCTC 2 cut(s) 523, 637
BstMBI GATC 1 cut(s) 545
BstMWI GCNNNNNNNGC 1 cut(s) 541
BstNI CCWGG 2 cut(s) 551, 576
BstPAI GACNNNNGTC 1 cut(s) 535
BstSCI CCNGG 2 cut(s) 549, 574
BstV2I GAAGAC 1 cut(s) 437
Bsu36I CCTNAGG 1 cut(s) 132
BtsCI GGATG 4 cut(s) 265, 487, 487, 491
Csp6I GTAC 2 cut(s) 45, 57
CspCI CAANNNNNGTGG 2 cut(s) 150, 185
CviAII CATG 4 cut(s) 21, 79, 341, 591
CviJI RGCY 4 cut(s) 165, 355, 535, 601
CviKI_1 RGCY 4 cut(s) 165, 355, 535, 601
CviQI GTAC 2 cut(s) 45, 57
DdeI CTNAG 5 cut(s) 12, 132, 305, 412, 620
DpnI GATC 1 cut(s) 547
DpnII GATC 1 cut(s) 545
Eco31I GGTCTC 1 cut(s) 637
Eco81I CCTNAGG 1 cut(s) 132
EcoRII CCWGG 2 cut(s) 549, 574
FaeI CATG 4 cut(s) 24, 82, 344, 594
FatI CATG 4 cut(s) 20, 78, 340, 590
FauI CCCGC 1 cut(s) 471
FokI GGATG 4 cut(s) 272, 474, 478, 494
GsuI CTGGAG 1 cut(s) 348
HapII CCGG 1 cut(s) 389
Hin1II CATG 4 cut(s) 24, 82, 344, 594
HinfI GANTC 4 cut(s) 98, 119, 410, 433
HpaII CCGG 1 cut(s) 389
Hpy166II GTNNAC 1 cut(s) 266
Hpy188I TCNGA 6 cut(s) 13, 39, 108, 348, 450, 639
Hpy188III TCNNGA 3 cut(s) 95, 131, 584
Hpy8I GTNNAC 1 cut(s) 266
HpyCH4V TGCA 1 cut(s) 558
HpyF10VI GCNNNNNNNGC 1 cut(s) 541
HpyF3I CTNAG 5 cut(s) 12, 132, 305, 412, 620
Hsp92II CATG 4 cut(s) 24, 82, 344, 594
Kzo9I GATC 1 cut(s) 545
LweI GCATC 2 cut(s) 472, 643
MaeIII GTNAC 1 cut(s) 454
MalI GATC 1 cut(s) 547
MboI GATC 1 cut(s) 545
MboII GAAGA 6 cut(s) 37, 60, 255, 274, 327, 442
MhlI GDGCHC 1 cut(s) 613
MluCI AATT 3 cut(s) 357, 417, 511
MlyI GAGTC 3 cut(s) 128, 404, 427
MmeI TCCRAC 1 cut(s) 326
MseI TTAA 1 cut(s) 237
MspA1I CMGCKG 2 cut(s) 309, 535
MspI CCGG 1 cut(s) 389
MspR9I CCNGG 2 cut(s) 551, 576
MvaI CCWGG 2 cut(s) 551, 576
MwoI GCNNNNNNNGC 1 cut(s) 541
NdeII GATC 1 cut(s) 545
NlaIII CATG 4 cut(s) 24, 82, 344, 594
NlaIV GGNNCC 2 cut(s) 251, 569
PfeI GAWTC 1 cut(s) 98
PleI GAGTC 3 cut(s) 127, 404, 427
PpsI GAGTC 3 cut(s) 127, 404, 427
PshAI GACNNNNGTC 1 cut(s) 535
Psp6I CCWGG 2 cut(s) 549, 574
PspGI CCWGG 2 cut(s) 549, 574
PspN4I GGNNCC 2 cut(s) 251, 569
PvuII CAGCTG 1 cut(s) 535
RsaI GTAC 2 cut(s) 46, 58
RsaNI GTAC 2 cut(s) 45, 57
SaqAI TTAA 1 cut(s) 237
Sau3AI GATC 1 cut(s) 545
ScaI AGTACT 1 cut(s) 46
SchI GAGTC 3 cut(s) 128, 404, 427
ScrFI CCNGG 2 cut(s) 551, 576
SduI GDGCHC 1 cut(s) 613
SetI ASST 5 cut(s) 167, 255, 334, 537, 603
SfaNI GCATC 2 cut(s) 472, 643
SmlI CTYRAG 1 cut(s) 93
SmoI CTYRAG 1 cut(s) 93
Sse9I AATT 3 cut(s) 357, 417, 511
SsiI CCGC 2 cut(s) 309, 478
StyD4I CCNGG 2 cut(s) 549, 574
TasI AATT 3 cut(s) 357, 417, 511
TatI WGTACW 1 cut(s) 44
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TspDTI ATGAA 5 cut(s) 9, 75, 233, 274, 443
TspGWI ACGGA 1 cut(s) 533
XapI RAATTY 1 cut(s) 511
ZrmI AGTACT 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.