Rh5CG572600

Protein trichome birefringence-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0001307
Physical Location & Seq
Reverse (-)
81029662 .. 81031369
1708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG572600.1

Sequence Viewer

Length: 633 bp
ATGGCAACCCAAAAACTGCAATCTCCCAAGGATGAATGGAAGGAACATGTTGGAATTATTGAGAGGAAAGCGTCTAGTTTTTGTTGGAGCGAATTTCGTACAGAGGGCGCCTACTTTTTTGTATTCAAGGATTACAATTGTTCAGTGGAGTTTGTTCAATCACCATTTCTAGTTCAAGAATCGGAGGTGCTGACCACAAATGGGTCAAAGAAGGAAACACTGCGCCTGGATATGATTCAGAAATCCTTGGATAAGTACAAAAGTGCAGATGTTCTCGTCTTCAACACAGGTCACTGGTGGACTCATGAGAAAACTTCCAGAGGGCAGGGTTACTATCAAGAGGGTGACTATATCTATAGTCAATTGAATGTCAAAGAGGCGTATGGTAAAGCTATAACAACACGGGCCAGATGGCTGGATGCTAATATAAATCCTGAAAAAACTGTTGTTTTCTTCCGGGGCTATTCGCCCAATCACTTTAGAACCTCATGGAGGGTTTACAACTATACATCATCTTCATGTTTGCTTTACCATTTCTTAGTGGTGGAAGATGGAATACTGGAGGTCAATGTCATGGTCGGACAGAGCCAATTCAATATGAGGGATACAAAGGAAAATATCCTGCAAAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PC-Esterase PMR5N

Protein Analysis

210

Amino Acids

24.68

Weight (kDa)

7.69

Isoelectric Point (pI)

42.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PC-Esterase PF13839 30 - 165 2.6e-36 GDSL/SGNH-like Acyl-Esterase family found in Pmr5 and Cas1p
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 107
AcsI RAATTY 1 cut(s) 92
AcyI GRCGYC 1 cut(s) 108
AfaI GTAC 2 cut(s) 100, 257
AfiI CCNNNNNNNGG 2 cut(s) 201, 492
AflIII ACRYGT 1 cut(s) 46
AgsI TTSAA 6 cut(s) 127, 158, 176, 283, 367, 595
AjnI CCWGG 1 cut(s) 225
AluBI AGCT 1 cut(s) 392
AluI AGCT 1 cut(s) 392
AoxI GGCC 1 cut(s) 405
ApoI RAATTY 1 cut(s) 92
AspLEI GCGC 2 cut(s) 110, 225
AspS9I GGNCC 1 cut(s) 405
AsuC2I CCSGG 1 cut(s) 458
AsuHPI GGTGA 2 cut(s) 153, 356
BanI GGYRCC 1 cut(s) 107
BarI GAAGNNNNNNTAC 2 cut(s) 540, 572
BbsI GAAGAC 1 cut(s) 271
BccI CCATC 2 cut(s) 405, 545
BciT130I CCWGG 1 cut(s) 227
BciVI GTATCC 1 cut(s) 598
BcnI CCSGG 1 cut(s) 458
BfaI CTAG 2 cut(s) 75, 170
BfmI CTRYAG 1 cut(s) 355
BfoI RGCGCY 1 cut(s) 111
BfuI GTATCC 1 cut(s) 598
Bme1390I CCNGG 2 cut(s) 227, 458
BmgT120I GGNCC 1 cut(s) 405
BmiI GGNNCC 1 cut(s) 109
BmrFI CCNGG 2 cut(s) 227, 458
BmsI GCATC 1 cut(s) 409
BpiI GAAGAC 1 cut(s) 271
BpmI CTGGAG 1 cut(s) 581
BpuMI CCSGG 1 cut(s) 458
BsaHI GRCGYC 1 cut(s) 108
BsaJI CCNNGG 3 cut(s) 27, 246, 457
Bsc4I CCNNNNNNNGG 2 cut(s) 201, 492
Bse1I ACTGG 2 cut(s) 299, 564
BseBI CCWGG 1 cut(s) 227
BseDI CCNNGG 3 cut(s) 27, 246, 457
BseGI GGATG 2 cut(s) 37, 424
BseLI CCNNNNNNNGG 2 cut(s) 201, 492
BseNI ACTGG 2 cut(s) 299, 564
BsgI GTGCAG 1 cut(s) 285
BshFI GGCC 1 cut(s) 407
BshNI GGYRCC 1 cut(s) 107
BsiSI CCGG 1 cut(s) 457
BslI CCNNNNNNNGG 2 cut(s) 201, 492
BsnI GGCC 1 cut(s) 407
BspANI GGCC 1 cut(s) 407
BspHI TCATGA 1 cut(s) 304
BspLI GGNNCC 1 cut(s) 109
BspT107I GGYRCC 1 cut(s) 107
BsrI ACTGG 2 cut(s) 299, 564
BssECI CCNNGG 3 cut(s) 27, 246, 457
BssNI GRCGYC 1 cut(s) 108
BssT1I CCWWGG 2 cut(s) 27, 246
Bst2UI CCWGG 1 cut(s) 227
Bst4CI ACNGT 1 cut(s) 445
BstACI GRCGYC 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 538
BstENI CCTNNNNNAGG 1 cut(s) 490
BstF5I GGATG 2 cut(s) 37, 424
BstH2I RGCGCY 1 cut(s) 111
BstHHI GCGC 2 cut(s) 110, 225
BstNI CCWGG 1 cut(s) 227
BstNSI RCATGY 1 cut(s) 50
BstSCI CCNGG 2 cut(s) 225, 456
BstSFI CTRYAG 1 cut(s) 355
BstV2I GAAGAC 1 cut(s) 271
BstXI CCANNNNNNTGG 1 cut(s) 415
BsuI GTATCC 1 cut(s) 598
BsuRI GGCC 1 cut(s) 407
BtsCI GGATG 2 cut(s) 37, 424
BtsI GCAGTG 1 cut(s) 218
BtsIMutI CAGTG 3 cut(s) 150, 218, 292
CciI TCATGA 1 cut(s) 304
CfoI GCGC 2 cut(s) 110, 225
Cfr13I GGNCC 1 cut(s) 405
CseI GACGC 1 cut(s) 60
Csp6I GTAC 2 cut(s) 99, 256
CviAII CATG 5 cut(s) 47, 305, 489, 519, 574
CviJI RGCY 5 cut(s) 392, 407, 415, 462, 588
CviKI_1 RGCY 5 cut(s) 392, 407, 415, 462, 588
CviQI GTAC 2 cut(s) 99, 256
DdeI CTNAG 1 cut(s) 538
DinI GGCGCC 1 cut(s) 109
Eco130I CCWWGG 2 cut(s) 27, 246
EcoNI CCTNNNNNAGG 1 cut(s) 490
EcoRII CCWGG 1 cut(s) 225
EcoT14I CCWWGG 2 cut(s) 27, 246
EgeI GGCGCC 1 cut(s) 109
EheI GGCGCC 1 cut(s) 109
ErhI CCWWGG 2 cut(s) 27, 246
FaeI CATG 5 cut(s) 50, 308, 492, 522, 577
FatI CATG 5 cut(s) 46, 304, 488, 518, 573
FokI GGATG 2 cut(s) 44, 431
FspBI CTAG 2 cut(s) 75, 170
GlaI GCGC 2 cut(s) 109, 224
GsuI CTGGAG 1 cut(s) 581
HaeII RGCGCY 1 cut(s) 111
HaeIII GGCC 1 cut(s) 407
HapII CCGG 1 cut(s) 457
HgaI GACGC 1 cut(s) 60
HhaI GCGC 2 cut(s) 110, 225
Hin1I GRCGYC 1 cut(s) 108
Hin1II CATG 5 cut(s) 50, 308, 492, 522, 577
Hin6I GCGC 2 cut(s) 108, 223
HinP1I GCGC 2 cut(s) 108, 223
HinfI GANTC 3 cut(s) 179, 235, 301
HpaII CCGG 1 cut(s) 457
HphI GGTGA 2 cut(s) 153, 356
Hpy166II GTNNAC 2 cut(s) 300, 499
Hpy188I TCNGA 3 cut(s) 184, 240, 581
Hpy188III TCNNGA 5 cut(s) 176, 305, 318, 338, 434
Hpy8I GTNNAC 2 cut(s) 300, 499
HpyAV CCTTC 2 cut(s) 34, 205
HpyCH4III ACNGT 1 cut(s) 445
HpyCH4V TGCA 3 cut(s) 19, 266, 625
HpyF3I CTNAG 1 cut(s) 538
Hsp92I GRCGYC 1 cut(s) 108
Hsp92II CATG 5 cut(s) 50, 308, 492, 522, 577
HspAI GCGC 2 cut(s) 108, 223
KasI GGCGCC 1 cut(s) 107
LmnI GCTCC 1 cut(s) 87
LweI GCATC 1 cut(s) 409
MaeI CTAG 2 cut(s) 75, 170
MaeIII GTNAC 3 cut(s) 290, 329, 344
MboII GAAGA 4 cut(s) 271, 445, 507, 560
MfeI CAATTG 2 cut(s) 136, 362
MluCI AATT 5 cut(s) 54, 92, 136, 362, 590
Mly113I GGCGCC 1 cut(s) 108
MlyI GAGTC 1 cut(s) 295
MmeI TCCRAC 3 cut(s) 31, 65, 559
MslI CAYNNNNRTG 1 cut(s) 517
MspI CCGG 1 cut(s) 457
MspR9I CCNGG 2 cut(s) 227, 458
MunI CAATTG 2 cut(s) 136, 362
MvaI CCWGG 1 cut(s) 227
NarI GGCGCC 1 cut(s) 108
NciI CCSGG 1 cut(s) 458
NlaIII CATG 5 cut(s) 50, 308, 492, 522, 577
NlaIV GGNNCC 1 cut(s) 109
NmuCI GTSAC 2 cut(s) 290, 344
NspI RCATGY 1 cut(s) 50
PagI TCATGA 1 cut(s) 304
PciI ACATGT 1 cut(s) 46
PfeI GAWTC 2 cut(s) 179, 235
PleI GAGTC 1 cut(s) 295
PluTI GGCGCC 1 cut(s) 111
PpsI GAGTC 1 cut(s) 295
PscI ACATGT 1 cut(s) 46
Psp6I CCWGG 1 cut(s) 225
PspGI CCWGG 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 109
PspPI GGNCC 1 cut(s) 405
RsaI GTAC 2 cut(s) 100, 257
RsaNI GTAC 2 cut(s) 99, 256
RseI CAYNNNNRTG 1 cut(s) 517
Sau96I GGNCC 1 cut(s) 405
SchI GAGTC 1 cut(s) 295
ScrFI CCNGG 2 cut(s) 227, 458
SetI ASST 5 cut(s) 189, 292, 394, 488, 567
SfaNI GCATC 1 cut(s) 409
SfcI CTRYAG 1 cut(s) 355
SfoI GGCGCC 1 cut(s) 109
SmiMI CAYNNNNRTG 1 cut(s) 517
Sse9I AATT 5 cut(s) 54, 92, 136, 362, 590
SspDI GGCGCC 1 cut(s) 107
SspMI CTAG 2 cut(s) 75, 170
StyD4I CCNGG 2 cut(s) 225, 456
StyI CCWWGG 2 cut(s) 27, 246
TaaI ACNGT 1 cut(s) 445
TasI AATT 5 cut(s) 54, 92, 136, 362, 590
TatI WGTACW 1 cut(s) 255
TfiI GAWTC 2 cut(s) 179, 235
TscAI CASTG 3 cut(s) 150, 225, 299
TseFI GTSAC 2 cut(s) 290, 344
Tsp45I GTSAC 2 cut(s) 290, 344
TspDTI ATGAA 2 cut(s) 48, 507
TspRI CASTG 3 cut(s) 150, 225, 299
XagI CCTNNNNNAGG 1 cut(s) 490
XapI RAATTY 1 cut(s) 92
XceI RCATGY 1 cut(s) 50
XspI CTAG 2 cut(s) 75, 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.