Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000432.1

Orthogroup ID

OG0001307

Physical Location & Seq

Genomic Coordinates Forward (+)

402385 .. 404604

Gene Structure 2220 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000432.1_g000119.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 954 bp

atgggtgcttctgagttttcaaggaagatgggaaatcagagcagtactcaaatgggtactgaccaatcttcaaaacccatgatttcgttgcctcaagaatccaatcggaccagaaatgagtcatcttttcctgagggttctaatggggaaaatggtttgccaagctatgtggcattgaagtccataagcaatgagggattgtctgggtttgagttgatgaatggttgtgatttgtttaatggaagatgggtgagagatgattcatacccagtttatgctgctggaatcggaggtgctaaccataaatgggtcaaagaaggaaacacccgcctggatatggttcagagatccttggataagtacaaaagtgcagatgttcttgtcttcaacacaggtcactggtggactcatgagaaaacttccagaggggttactatcaagagggtgctatatcaactgaatgttaaagaggcgtatggaaaagctataacaacatgggccagatggctggatgctaatataaatcctgaaaactctattgttttcttccggaacctcttggatggtttacaactatacaccatcttcatatttgctttaccatttctcagcggtggaagatggaatactggaggtcaatgtcatggtcggacagagccaattcaatacgaggcatacaaaggaaaatatccggcaaagatgagaatactggactcagtaattagggagatgaagactccaatcttttatctgaatgtttcaaaaatgactgattttcggcgggatgctcatccacccatttacagaaagcagaatttgacagaggaggagagacagctgtatttgcgatcccaggattgcagtcattggtgcctccctggggttcgtgatacatggaacgagcttctatgtgctcatctccttagatatatccagcatcggaggagaccatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PC-Esterase PMR5N

Protein Analysis

317

Amino Acids

36.51

Weight (kDa)

9.34

Isoelectric Point (pI)

49.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001307)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G49340
fragaria_vesca	FvH4_3g44450 FvH4_3g44450 FvH4_3g44450 FvH4_3g44450 FvH4_3g44450 FvH4_3g44450 FvH4_3g44460 FvH4_3g44460 FvH4_3g44460
malus_domestica	MD03G1012500.v1.1 MD03G1012600.v1.1 MD03G1013000.v1.1 MD03G1013100.v1.1 MD03G1013400.v1.1 MD03G1013500.v1.1 MD11G1015200.v1.1
prunus_persica	Prupe.6G013100_v2.0.a1 Prupe.6G013300_v2.0.a1
pyrus_communis	pycom02g13780 pycom03g01130
rosa_chinensis	RchiOBHm_Chr5g0081011 RchiOBHm_Chr5g0081071 RchiOBHm_Chr5g0081121 RchiOBHm_Chr5g0081131
rosa_laevigata	RLG00000036911 RLG00000036913
rosa_multiflora	Rmu_sc0006274.1_g000005 Rmu_ssc0000432.1_g000079 Rmu_ssc0000432.1_g000080 Rmu_ssc0000432.1_g000113 Rmu_ssc0000432.1_g000119
rosa_roxburghii	Rroxscaffold_1G00002310 Rroxscaffold_1G00002320 Rroxscaffold_1G00002470
rosa_rugosa	Rorug05G0473500 Rorug05G0473600
rosa_samantha	Rh5AG525800 Rh5AG526000 Rh5AG526100 Rh5BG549700 Rh5BG549900 Rh5BG550300 Rh5BG550400 Rh5CG572600 Rh5CG573200 Rh5CG573300 Rh5DG560000 Rh5DG560100
rosa_wichuraiana	Rw0G002560 Rw0G002570 Rw0G012050 Rw5G048870 Rw5G048880

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	870
AccIII	TCCGGA	1 cut(s)	549
AciI	CCGC	3 cut(s)	328, 612, 781
AclWI	GGATC	2 cut(s)	342, 843
AcsI	RAATTY	1 cut(s)	814
AfaI	GTAC	3 cut(s)	46, 58, 362
AfiI	CCNNNNNNNGG	3 cut(s)	307, 337, 880
AgsI	TTSAA	6 cut(s)	21, 72, 178, 388, 665, 762
AjnI	CCWGG	3 cut(s)	330, 852, 877
AluBI	AGCT	4 cut(s)	165, 485, 838, 904
AluI	AGCT	4 cut(s)	165, 485, 838, 904
Alw21I	GWGCWC	1 cut(s)	916
Alw26I	GTCTC	2 cut(s)	826, 940
AlwI	GGATC	2 cut(s)	342, 843
Aor13HI	TCCGGA	1 cut(s)	549
AoxI	GGCC	1 cut(s)	498
ApeKI	GCWGC	1 cut(s)	278
ApoI	RAATTY	1 cut(s)	814
AspS9I	GGNCC	2 cut(s)	108, 498
AsuHPI	GGTGA	1 cut(s)	262
AvaII	GGWCC	1 cut(s)	108
AxyI	CCTNAGG	1 cut(s)	132
BanI	GGYRCC	1 cut(s)	870
BarI	GAAGNNNNNNTAC	2 cut(s)	610, 642
BbsI	GAAGAC	2 cut(s)	376, 740
Bbv12I	GWGCWC	1 cut(s)	916
BbvI	GCAGC	1 cut(s)	265
BccI	CCATC	6 cut(s)	22, 240, 498, 557, 590, 615
BciT130I	CCWGG	3 cut(s)	332, 854, 879
BcoDI	GTCTC	2 cut(s)	826, 940
BisI	GCNGC	1 cut(s)	279
BlsI	GCNGC	1 cut(s)	280
BmcAI	AGTACT	1 cut(s)	46
Bme1390I	CCNGG	3 cut(s)	332, 854, 879
Bme18I	GGWCC	1 cut(s)	108
BmgT120I	GGNCC	2 cut(s)	108, 498
BmiI	GGNNCC	2 cut(s)	554, 872
BmrFI	CCNGG	3 cut(s)	332, 854, 879
BmrI	ACTGGG	1 cut(s)	263
BmsI	GCATC	3 cut(s)	502, 775, 946
BmuI	ACTGGG	1 cut(s)	263
BpiI	GAAGAC	2 cut(s)	376, 740
BplI	GAGNNNNNCTC	2 cut(s)	31, 63
BpmI	CTGGAG	1 cut(s)	651
BpuEI	CTTGAG	1 cut(s)	78
BsaBI	GATNNNNATC	1 cut(s)	789
BsaI	GGTCTC	1 cut(s)	940
BsaJI	CCNNGG	4 cut(s)	351, 852, 877, 878
BsaWI	WCCGGW	1 cut(s)	549
Bsc4I	CCNNNNNNNGG	3 cut(s)	307, 337, 880
Bse1I	ACTGG	4 cut(s)	269, 404, 634, 714
Bse21I	CCTNAGG	1 cut(s)	132
Bse3DI	GCAATG	1 cut(s)	196
Bse8I	GATNNNNATC	1 cut(s)	789
BseAI	TCCGGA	1 cut(s)	549
BseBI	CCWGG	3 cut(s)	332, 854, 879
BseDI	CCNNGG	4 cut(s)	351, 852, 877, 878
BseGI	GGATG	4 cut(s)	517, 568, 790, 790
BseJI	GATNNNNATC	1 cut(s)	789
BseLI	CCNNNNNNNGG	3 cut(s)	307, 337, 880
BseMI	GCAATG	1 cut(s)	196
BseMII	CTCAG	3 cut(s)	123, 622, 729
BseNI	ACTGG	4 cut(s)	269, 404, 634, 714
BseRI	GAGGAG	2 cut(s)	839, 842
BseXI	GCAGC	1 cut(s)	265
BsgI	GTGCAG	1 cut(s)	390
BshFI	GGCC	1 cut(s)	500
BshNI	GGYRCC	1 cut(s)	870
BsiHKAI	GWGCWC	1 cut(s)	916
BsiSI	CCGG	2 cut(s)	550, 692
BslI	CCNNNNNNNGG	3 cut(s)	307, 337, 880
BsmAI	GTCTC	2 cut(s)	826, 940
BsnI	GGCC	1 cut(s)	500
Bso31I	GGTCTC	1 cut(s)	940
Bsp1286I	GDGCHC	1 cut(s)	916
Bsp13I	TCCGGA	1 cut(s)	549
Bsp143I	GATC	2 cut(s)	347, 848
BspACI	CCGC	3 cut(s)	328, 612, 781
BspANI	GGCC	1 cut(s)	500
BspCNI	CTCAG	4 cut(s)	4, 124, 621, 728
BspEI	TCCGGA	1 cut(s)	549
BspHI	TCATGA	1 cut(s)	409
BspLI	GGNNCC	2 cut(s)	554, 872
BspPI	GGATC	2 cut(s)	342, 843
BspT107I	GGYRCC	1 cut(s)	870
BspTNI	GGTCTC	1 cut(s)	940
BsrDI	GCAATG	1 cut(s)	196
BsrI	ACTGG	4 cut(s)	269, 404, 634, 714
BssECI	CCNNGG	4 cut(s)	351, 852, 877, 878
BssMI	GATC	2 cut(s)	347, 848
BssT1I	CCWWGG	1 cut(s)	351
Bst2UI	CCWGG	3 cut(s)	332, 854, 879
BstDEI	CTNAG	5 cut(s)	12, 132, 608, 715, 923
BstF5I	GGATG	4 cut(s)	517, 568, 790, 790
BstKTI	GATC	2 cut(s)	350, 851
BstMAI	GTCTC	2 cut(s)	826, 940
BstMBI	GATC	2 cut(s)	347, 848
BstMWI	GCNNNNNNNGC	1 cut(s)	844
BstNI	CCWGG	3 cut(s)	332, 854, 879
BstSCI	CCNGG	3 cut(s)	330, 852, 877
BstV1I	GCAGC	1 cut(s)	265
BstV2I	GAAGAC	2 cut(s)	376, 740
BstX2I	RGATCY	1 cut(s)	347
BstXI	CCANNNNNNTGG	1 cut(s)	508
BstYI	RGATCY	1 cut(s)	347
Bsu36I	CCTNAGG	1 cut(s)	132
BsuRI	GGCC	1 cut(s)	500
BtsCI	GGATG	4 cut(s)	517, 568, 790, 790
BtsIMutI	CAGTG	1 cut(s)	397
CciI	TCATGA	1 cut(s)	409
Cfr13I	GGNCC	2 cut(s)	108, 498
Csp6I	GTAC	3 cut(s)	45, 57, 361
CspCI	CAANNNNNGTGG	2 cut(s)	150, 185
CviAII	CATG	5 cut(s)	79, 410, 495, 644, 894
CviJI	RGCY	7 cut(s)	165, 485, 500, 508, 658, 838, 904
CviKI_1	RGCY	7 cut(s)	165, 485, 500, 508, 658, 838, 904
CviQI	GTAC	3 cut(s)	45, 57, 361
DdeI	CTNAG	5 cut(s)	12, 132, 608, 715, 923
DpnI	GATC	2 cut(s)	349, 850
DpnII	GATC	2 cut(s)	347, 848
Eco130I	CCWWGG	1 cut(s)	351
Eco31I	GGTCTC	1 cut(s)	940
Eco47I	GGWCC	1 cut(s)	108
Eco81I	CCTNAGG	1 cut(s)	132
EcoRII	CCWGG	3 cut(s)	330, 852, 877
EcoT14I	CCWWGG	1 cut(s)	351
ErhI	CCWWGG	1 cut(s)	351
FaeI	CATG	5 cut(s)	82, 413, 498, 647, 897
FatI	CATG	5 cut(s)	78, 409, 494, 643, 893
FauI	CCCGC	2 cut(s)	335, 774
Fnu4HI	GCNGC	1 cut(s)	279
FokI	GGATG	4 cut(s)	524, 575, 777, 797
Fsp4HI	GCNGC	1 cut(s)	279
GluI	GCNGC	1 cut(s)	279
GsuI	CTGGAG	1 cut(s)	651
HaeIII	GGCC	1 cut(s)	500
HapII	CCGG	2 cut(s)	550, 692
Hin1II	CATG	5 cut(s)	82, 413, 498, 647, 897
HinfI	GANTC	7 cut(s)	98, 119, 260, 285, 406, 713, 736
HpaII	CCGG	2 cut(s)	550, 692
HphI	GGTGA	1 cut(s)	262
Hpy166II	GTNNAC	2 cut(s)	405, 569
Hpy188I	TCNGA	8 cut(s)	13, 39, 108, 290, 345, 651, 753, 942
Hpy188III	TCNNGA	8 cut(s)	95, 131, 410, 423, 439, 527, 550, 887
Hpy8I	GTNNAC	2 cut(s)	405, 569
HpyAV	CCTTC	1 cut(s)	311
HpyCH4V	TGCA	2 cut(s)	371, 861
HpyF10VI	GCNNNNNNNGC	1 cut(s)	844
HpyF3I	CTNAG	5 cut(s)	12, 132, 608, 715, 923
Hsp92II	CATG	5 cut(s)	82, 413, 498, 647, 897
Kpn2I	TCCGGA	1 cut(s)	549
Kzo9I	GATC	2 cut(s)	347, 848
Lsp1109I	GCAGC	1 cut(s)	265
LweI	GCATC	3 cut(s)	502, 775, 946
MaeIII	GTNAC	2 cut(s)	395, 430
MalI	GATC	2 cut(s)	349, 850
MboI	GATC	2 cut(s)	347, 848
MboII	GAAGA	8 cut(s)	37, 60, 255, 376, 538, 577, 630, 745
MflI	RGATCY	1 cut(s)	347
MhlI	GDGCHC	1 cut(s)	916
MluCI	AATT	3 cut(s)	660, 720, 814
MlyI	GAGTC	4 cut(s)	128, 400, 707, 730
MmeI	TCCRAC	1 cut(s)	629
MroI	TCCGGA	1 cut(s)	549
MseI	TTAA	2 cut(s)	237, 465
MspA1I	CMGCKG	2 cut(s)	612, 838
MspI	CCGG	2 cut(s)	550, 692
MspR9I	CCNGG	3 cut(s)	332, 854, 879
MvaI	CCWGG	3 cut(s)	332, 854, 879
MwoI	GCNNNNNNNGC	1 cut(s)	844
NdeII	GATC	2 cut(s)	347, 848
NlaIII	CATG	5 cut(s)	82, 413, 498, 647, 897
NlaIV	GGNNCC	2 cut(s)	554, 872
NmuCI	GTSAC	1 cut(s)	395
PagI	TCATGA	1 cut(s)	409
PasI	CCCWGGG	1 cut(s)	878
PfeI	GAWTC	3 cut(s)	98, 260, 285
PkrI	GCNGC	1 cut(s)	280
PleI	GAGTC	4 cut(s)	127, 400, 707, 730
PpsI	GAGTC	4 cut(s)	127, 400, 707, 730
Psp6I	CCWGG	3 cut(s)	330, 852, 877
PspGI	CCWGG	3 cut(s)	330, 852, 877
PspN4I	GGNNCC	2 cut(s)	554, 872
PspPI	GGNCC	2 cut(s)	108, 498
PsuI	RGATCY	1 cut(s)	347
PvuII	CAGCTG	1 cut(s)	838
RsaI	GTAC	3 cut(s)	46, 58, 362
RsaNI	GTAC	3 cut(s)	45, 57, 361
SaqAI	TTAA	2 cut(s)	237, 465
SatI	GCNGC	1 cut(s)	279
Sau3AI	GATC	2 cut(s)	347, 848
Sau96I	GGNCC	2 cut(s)	108, 498
ScaI	AGTACT	1 cut(s)	46
SchI	GAGTC	4 cut(s)	128, 400, 707, 730
ScrFI	CCNGG	3 cut(s)	332, 854, 879
SduI	GDGCHC	1 cut(s)	916
SetI	ASST	8 cut(s)	167, 295, 397, 487, 558, 637, 840, 906
SfaNI	GCATC	3 cut(s)	502, 775, 946
SinI	GGWCC	1 cut(s)	108
SmlI	CTYRAG	1 cut(s)	93
SmoI	CTYRAG	1 cut(s)	93
Sse9I	AATT	3 cut(s)	660, 720, 814
SsiI	CCGC	3 cut(s)	328, 612, 781
StyD4I	CCNGG	3 cut(s)	330, 852, 877
StyI	CCWWGG	1 cut(s)	351
TasI	AATT	3 cut(s)	660, 720, 814
TatI	WGTACW	2 cut(s)	44, 360
TfiI	GAWTC	3 cut(s)	98, 260, 285
Tru1I	TTAA	2 cut(s)	237, 465
Tru9I	TTAA	2 cut(s)	237, 465
TscAI	CASTG	1 cut(s)	404
TseFI	GTSAC	1 cut(s)	395
TseI	GCWGC	1 cut(s)	278
Tsp45I	GTSAC	1 cut(s)	395
TspDTI	ATGAA	4 cut(s)	233, 252, 577, 746
TspRI	CASTG	1 cut(s)	404
VpaK11BI	GGWCC	1 cut(s)	108
XapI	RAATTY	1 cut(s)	814
ZrmI	AGTACT	1 cut(s)	46

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.