Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007193.1

Orthogroup ID

OG0001698

Physical Location & Seq

Genomic Coordinates Reverse (-)

11191 .. 11451

Gene Structure 261 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007193.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

atgggagcaataagagctataaaattcacctctgatggtcgttttatggccatggctgagccagcagactttgttcacatcattgatacccagtccggatatgcaaaggaacaagagattgatctgtttggtgagattgccggaatatccttcagccccgactctgaagctttgtttattggggttgctgatcgcacatatggtagtgtattggagttcaataagaggcactataatccctatcaagaaatagtcttctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

86

Amino Acids

9.64

Weight (kDa)

4.63

Isoelectric Point (pI)

52.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001698)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G36070 AT1G36070 AT1G36070 AT1G36070 AT1G36070 AT1G78070 AT1G78070 AT1G78070
fragaria_vesca	FvH4_5g37830
malus_domestica	MD08G1180000.v1.1 MD15G1365300.v1.1
prunus_persica	Prupe.1G513500_v2.0.a1
pyrus_communis	pycom08g15410 pycom15g32770
rosa_chinensis	RchiOBHm_Chr7g0239721 RchiOBHm_Chr7g0239731 RchiOBHm_Chr7g0239761 RchiOBHm_Chr7g0239781 RchiOBHm_Chr7g0239801
rosa_laevigata	RLG00000000730 RLG00000000732 RLG00000029177
rosa_multiflora	Rmu_sc0000063.1_g000032 Rmu_sc0000063.1_g000033 Rmu_sc0000063.1_g000038 Rmu_sc0000101.1_g000005 Rmu_sc0000101.1_g000014 Rmu_sc0000101.1_g000017 Rmu_sc0000101.1_g000020 Rmu_sc0003622.1_g000011 Rmu_sc0004440.1_g000004 Rmu_sc0007193.1_g000002
rosa_roxburghii	Rroxscaffold_3G00220800 Rroxscaffold_3G00220820
rosa_rugosa	Rorug07G0328900.1 Rorug07G0329400
rosa_samantha	Rh7AG483100 Rh7AG483200 Rh7AG483300 Rh7AG483500 Rh7CG500900 Rh7CG501100
rosa_wichuraiana	Rw7G040440 Rw7G040470 Rw7G040480 Rw7G040520 Rw7G040540 Rw7G040560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	95
AcoI	YGGCCR	1 cut(s)	48
AcsI	RAATTY	1 cut(s)	23
AcuI	CTGAAG	2 cut(s)	136, 186
AgsI	TTSAA	1 cut(s)	220
AluBI	AGCT	2 cut(s)	17, 170
AluI	AGCT	2 cut(s)	17, 170
Aor13HI	TCCGGA	1 cut(s)	95
AoxI	GGCC	1 cut(s)	48
ApoI	RAATTY	1 cut(s)	23
AsuHPI	GGTGA	2 cut(s)	19, 143
BalI	TGGCCA	1 cut(s)	50
BbsI	GAAGAC	1 cut(s)	247
BccI	CCATC	1 cut(s)	29
BfaI	CTAG	1 cut(s)	259
BlpI	GCTNAGC	1 cut(s)	57
BmrI	ACTGGG	1 cut(s)	85
BmuI	ACTGGG	1 cut(s)	85
BpiI	GAAGAC	1 cut(s)	247
Bpu1102I	GCTNAGC	1 cut(s)	57
BsaJI	CCNNGG	1 cut(s)	51
BsaWI	WCCGGW	1 cut(s)	95
Bse1I	ACTGG	1 cut(s)	91
BseAI	TCCGGA	1 cut(s)	95
BseDI	CCNNGG	1 cut(s)	51
BseMII	CTCAG	1 cut(s)	48
BseNI	ACTGG	1 cut(s)	91
BshFI	GGCC	1 cut(s)	50
BsiSI	CCGG	2 cut(s)	96, 141
BsnI	GGCC	1 cut(s)	50
Bsp13I	TCCGGA	1 cut(s)	95
Bsp143I	GATC	2 cut(s)	121, 190
Bsp1720I	GCTNAGC	1 cut(s)	57
Bsp19I	CCATGG	1 cut(s)	51
BspANI	GGCC	1 cut(s)	50
BspCNI	CTCAG	1 cut(s)	49
BspEI	TCCGGA	1 cut(s)	95
BsrI	ACTGG	1 cut(s)	91
BssECI	CCNNGG	1 cut(s)	51
BssMI	GATC	2 cut(s)	121, 190
BssT1I	CCWWGG	1 cut(s)	51
BstC8I	GCNNGC	1 cut(s)	63
BstDEI	CTNAG	1 cut(s)	57
BstDSI	CCRYGG	1 cut(s)	51
BstKTI	GATC	2 cut(s)	124, 193
BstMBI	GATC	2 cut(s)	121, 190
BstMWI	GCNNNNNNNGC	2 cut(s)	14, 62
BstV2I	GAAGAC	1 cut(s)	247
BsuRI	GGCC	1 cut(s)	50
BtgI	CCRYGG	1 cut(s)	51
Cac8I	GCNNGC	1 cut(s)	63
CviAII	CATG	1 cut(s)	52
CviJI	RGCY	6 cut(s)	17, 50, 56, 61, 156, 170
CviKI_1	RGCY	6 cut(s)	17, 50, 56, 61, 156, 170
DdeI	CTNAG	1 cut(s)	57
DpnI	GATC	2 cut(s)	123, 192
DpnII	GATC	2 cut(s)	121, 190
EaeI	YGGCCR	1 cut(s)	48
Eco130I	CCWWGG	1 cut(s)	51
Eco57I	CTGAAG	2 cut(s)	136, 186
EcoT14I	CCWWGG	1 cut(s)	51
ErhI	CCWWGG	1 cut(s)	51
FaeI	CATG	1 cut(s)	55
FaiI	YATR	7 cut(s)	20, 47, 53, 102, 199, 201, 234
FatI	CATG	1 cut(s)	51
FauNDI	CATATG	1 cut(s)	199
FspBI	CTAG	1 cut(s)	259
HaeIII	GGCC	1 cut(s)	50
HapII	CCGG	2 cut(s)	96, 141
Hin1II	CATG	1 cut(s)	55
HindIII	AAGCTT	1 cut(s)	168
HinfI	GANTC	1 cut(s)	161
HpaII	CCGG	2 cut(s)	96, 141
HphI	GGTGA	2 cut(s)	19, 143
Hpy166II	GTNNAC	1 cut(s)	76
Hpy188I	TCNGA	2 cut(s)	34, 166
Hpy188III	TCNNGA	2 cut(s)	96, 245
Hpy8I	GTNNAC	1 cut(s)	76
HpyAV	CCTTC	1 cut(s)	160
HpyCH4V	TGCA	1 cut(s)	104
HpyF10VI	GCNNNNNNNGC	2 cut(s)	14, 62
HpyF3I	CTNAG	1 cut(s)	57
Hsp92II	CATG	1 cut(s)	55
Kpn2I	TCCGGA	1 cut(s)	95
Kzo9I	GATC	2 cut(s)	121, 190
LmnI	GCTCC	1 cut(s)	5
LpnPI	CCDG	4 cut(s)	75, 104, 109, 154
MaeI	CTAG	1 cut(s)	259
MalI	GATC	2 cut(s)	123, 192
MboI	GATC	2 cut(s)	121, 190
MboII	GAAGA	1 cut(s)	247
MlsI	TGGCCA	1 cut(s)	50
MluCI	AATT	1 cut(s)	23
MluNI	TGGCCA	1 cut(s)	50
MlyI	GAGTC	1 cut(s)	155
MnlI	CCTC	2 cut(s)	40, 219
Mox20I	TGGCCA	1 cut(s)	50
MroI	TCCGGA	1 cut(s)	95
MscI	TGGCCA	1 cut(s)	50
Msp20I	TGGCCA	1 cut(s)	50
MspI	CCGG	2 cut(s)	96, 141
MwoI	GCNNNNNNNGC	2 cut(s)	14, 62
NcoI	CCATGG	1 cut(s)	51
NdeI	CATATG	1 cut(s)	199
NdeII	GATC	2 cut(s)	121, 190
NlaIII	CATG	1 cut(s)	55
PleI	GAGTC	1 cut(s)	155
PpsI	GAGTC	1 cut(s)	155
Sau3AI	GATC	2 cut(s)	121, 190
SchI	GAGTC	1 cut(s)	155
SetI	ASST	3 cut(s)	19, 32, 172
SgeI	CNNG	8 cut(s)	64, 74, 103, 108, 125, 153, 170, 257
Sse9I	AATT	1 cut(s)	23
SspMI	CTAG	1 cut(s)	259
StyI	CCWWGG	1 cut(s)	51
TasI	AATT	1 cut(s)	23
XapI	RAATTY	1 cut(s)	23
XspI	CTAG	1 cut(s)	259

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.