Rroxscaffold_3G00220820

WD repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
3308944 .. 3309514
571 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00220820.1

Sequence Viewer

Length: 279 bp
ATGCATTGGAACTCTTTGCACAGGAGAGGCACCGAAGTACTCAATGTGGCTAAACCAATTGTACCTACTGAGAAACGACCTGGGTTGCTGGCACGACCACTCTCTAGAGTGCAGATAAGCACTATGGCTGTGAAGGAAAATTTGTTGGTTGCTGGGGGCTTCCAAGGTGAACTAATCTGCAAGCACATGAAACAACCTGGAGTTGCTTTCTGCTCAAAACTAACAACAGATGAGAATGCCATCACTAATGCAGTGGATATTTTCCGAAACCCAACGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.16

Weight (kDa)

9.78

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 29
AcsI RAATTY 1 cut(s) 139
AfaI GTAC 2 cut(s) 39, 63
AjnI CCWGG 2 cut(s) 79, 196
ApoI RAATTY 1 cut(s) 139
AsuHPI GGTGA 1 cut(s) 179
BanI GGYRCC 1 cut(s) 29
BccI CCATC 1 cut(s) 248
BciT130I CCWGG 2 cut(s) 81, 198
BfaI CTAG 1 cut(s) 105
BmcAI AGTACT 1 cut(s) 39
Bme1390I CCNGG 2 cut(s) 81, 198
BmiI GGNNCC 1 cut(s) 31
BmrFI CCNGG 2 cut(s) 81, 198
BpmI CTGGAG 1 cut(s) 219
BsaJI CCNNGG 2 cut(s) 80, 163
BseBI CCWGG 2 cut(s) 81, 198
BseDI CCNNGG 2 cut(s) 80, 163
BseMII CTCAG 1 cut(s) 60
BseYI CCCAGC 1 cut(s) 152
BsgI GTGCAG 1 cut(s) 131
BshNI GGYRCC 1 cut(s) 29
BsmI GAATGC 1 cut(s) 241
BspCNI CTCAG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 31
BspT107I GGYRCC 1 cut(s) 29
BssECI CCNNGG 2 cut(s) 80, 163
BssT1I CCWWGG 1 cut(s) 163
Bst2UI CCWGG 2 cut(s) 81, 198
BstC8I GCNNGC 2 cut(s) 90, 182
BstDEI CTNAG 1 cut(s) 69
BstNI CCWGG 2 cut(s) 81, 198
BstSCI CCNGG 2 cut(s) 79, 196
BtsI GCAGTG 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 258
Cac8I GCNNGC 2 cut(s) 90, 182
Csp6I GTAC 2 cut(s) 38, 62
CviAII CATG 1 cut(s) 187
CviJI RGCY 3 cut(s) 50, 128, 159
CviKI_1 RGCY 3 cut(s) 50, 128, 159
CviQI GTAC 2 cut(s) 38, 62
DdeI CTNAG 1 cut(s) 69
Eco130I CCWWGG 1 cut(s) 163
EcoRII CCWGG 2 cut(s) 79, 196
EcoT14I CCWWGG 1 cut(s) 163
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 163
FaeI CATG 1 cut(s) 190
FaiI YATR 2 cut(s) 125, 188
FatI CATG 1 cut(s) 186
FspBI CTAG 1 cut(s) 105
GsaI CCCAGC 1 cut(s) 156
GsuI CTGGAG 1 cut(s) 219
Hin1II CATG 1 cut(s) 190
HphI GGTGA 1 cut(s) 179
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 266
Hpy188III TCNNGA 1 cut(s) 105
Hpy8I GTNNAC 1 cut(s) 170
HpyAV CCTTC 1 cut(s) 127
HpyCH4IV ACGT 1 cut(s) 275
HpyCH4V TGCA 5 cut(s) 4, 19, 112, 180, 251
HpyF3I CTNAG 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 275
Hsp92II CATG 1 cut(s) 190
LpnPI CCDG 7 cut(s) 7, 66, 74, 93, 138, 183, 210
MaeI CTAG 1 cut(s) 105
MaeII ACGT 1 cut(s) 275
MfeI CAATTG 1 cut(s) 57
MluCI AATT 2 cut(s) 57, 139
MnlI CCTC 1 cut(s) 20
Mph1103I ATGCAT 1 cut(s) 6
MspR9I CCNGG 2 cut(s) 81, 198
MunI CAATTG 1 cut(s) 57
Mva1269I GAATGC 1 cut(s) 241
MvaI CCWGG 2 cut(s) 81, 198
NlaIII CATG 1 cut(s) 190
NlaIV GGNNCC 1 cut(s) 31
NsiI ATGCAT 1 cut(s) 6
PctI GAATGC 1 cut(s) 241
Psp6I CCWGG 2 cut(s) 79, 196
PspFI CCCAGC 1 cut(s) 152
PspGI CCWGG 2 cut(s) 79, 196
PspN4I GGNNCC 1 cut(s) 31
RsaI GTAC 2 cut(s) 39, 63
RsaNI GTAC 2 cut(s) 38, 62
ScaI AGTACT 1 cut(s) 39
ScrFI CCNGG 2 cut(s) 81, 198
SetI ASST 5 cut(s) 67, 82, 169, 199, 278
Sse9I AATT 2 cut(s) 57, 139
SspMI CTAG 1 cut(s) 105
StyD4I CCNGG 2 cut(s) 79, 196
StyI CCWWGG 1 cut(s) 163
TaiI ACGT 1 cut(s) 278
TasI AATT 2 cut(s) 57, 139
TatI WGTACW 1 cut(s) 37
TscAI CASTG 1 cut(s) 258
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 1 cut(s) 258
XapI RAATTY 1 cut(s) 139
XbaI TCTAGA 1 cut(s) 104
XspI CTAG 1 cut(s) 105
ZrmI AGTACT 1 cut(s) 39
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.