Rmu_sc0008017.1_g000003

E3 ubiquitin-protein ligase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008017.1
OG0001131
Physical Location & Seq
Forward (+)
6934 .. 11804
4871 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008017.1_g000003.1.cds

Sequence Viewer

Length: 1872 bp
atgggtcaggggctgagttgcggagagcctcgggagattggtctgtttggggccgtggaaaatggggacttggagggggttcaggatattgtggaagctgaccccagtgttttggaccagagaaaaggccgtggcaagctttctgctatgcatgtagctgctgctggtggtcagatcgaggttctttccatgcttttggatcggtctgttagtccggatgtagtgaatcgccataagcagactccgctgatgttggctgcaatgcatgggaatatcgcatgcgttagaaagctaatccaagcaggagcaaatatattgatgttcgattccttaaatggaagaacttgcctgcattatgctgcatattatggccattcagactgcctccaagcctttttatccgccgcacaatccaccactgttgcaaattcttggggatttgcaagatttgtgaatattagagatggaggtggagcaaccccattgcacttggctgcccgtcaaaaacgggccgagtgtgtgcatgttcttttggatagcggggctcttgtttgtgcttcaactggtggatacagctaccctggaagcacaccacttcatttagcagctcgtgctggttctttagattgcgtcagagagttgcttgcttggggagcggatcggcttcaattagactcatcagggagaatcccatacctggttgctctgaagcacaagcacagagcatgtgccgcgatactgaacccttcatcagcagagcctcttgtctggccatcacctttgaagtttatcagcgaacttaatccagaggctaaagctttgttggagaaggctttaatggaatcaaacatggagagggagaaagctatcttgaaggagacagtctccattccatctcctttgcattcagatgtagagggtgatgataatgcctctgaggctaccgatgtggatctatgctgcatatgctttgaccagttatgcacaattgaggttggaccatgtggtcatcaaatgtgtgcacattgcaccctcgccctctgctgccacaagaagcccaacccctcatctctatcttgccctacagtccctgtttgccccttttgtcggaccagcatcacccaactagttgttgccaatatcaaggccaacaatgatgtggaggtggaaatgagtccctcaaaaccaaggaaatcaagaaaatctaatgtcagtgaaggcagcagcagcttcaagggcctgtcgcctttgggctcatttggaagattgggtggtcgcaattcaggaaggatggagctagctatcttgaatttgcttgaggagcgagaccatcaccgcagtgaacttaatccagaggctaaagctttgttggagaaggctttaatggaatcaaacatggagagggagaaagctatcttgaaggagatagtctccattccatctcctttgcattcagatgtagagggtgatgataatgcctctgaggctaccgatgtggatctatgctgcatatgctttgaccagttatgcacaattgaggttggaccatgtggtcatcaaatgtgtgcacattgcaccctcgccctctgctgccacaagaagcccaacccctcatctctatcttgccctacagtccctgtttgccccttttgtcggaccagcatcacccaactagttgttgccaatatcaaggccaacaatgatgtggaggtggaaatgagtccctcaaaaccaaggaaatcaagaaaatctaatgtcagtgaaggcagcagcagcttcaagggcctgtcgcctttgggctcatttggaagattgggtggtcgcaattcaggaagggtatctgctgaatgcaatgaagacatcaagccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank Ank_2 Ank_4

Protein Analysis

623

Amino Acids

66.72

Weight (kDa)

6.38

Isoelectric Point (pI)

50.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 1005, 1551
AccBSI CCGCTC 1 cut(s) 656
AccII CGCG 1 cut(s) 734
AccIII TCCGGA 1 cut(s) 214
AciI CCGC 8 cut(s) 21, 245, 402, 405, 540, 656, 732, 1336
AclWI GGATC 4 cut(s) 207, 666, 960, 1506
AcoI YGGCCR 2 cut(s) 370, 770
AcsI RAATTY 2 cut(s) 427, 1309
AcuI CTGAAG 1 cut(s) 728
AfiI CCNNNNNNNGG 3 cut(s) 697, 1107, 1653
AgsI TTSAA 8 cut(s) 561, 668, 784, 874, 1234, 1309, 1420, 1780
AhlI ACTAGT 2 cut(s) 1126, 1672
AjnI CCWGG 2 cut(s) 580, 696
AleI CACNNNNGTG 1 cut(s) 1338
Alw21I GWGCWC 2 cut(s) 1024, 1570
Alw26I GTCTC 4 cut(s) 872, 889, 1320, 1435
Alw44I GTGCAC 2 cut(s) 1020, 1566
AlwI GGATC 4 cut(s) 207, 666, 960, 1506
AlwNI CAGNNNCTG 3 cut(s) 13, 1091, 1637
Ama87I CYCGRG 1 cut(s) 30
Aor13HI TCCGGA 1 cut(s) 214
AoxI GGCC 9 cut(s) 51, 127, 370, 510, 770, 1146, 1237, 1692, 1783
ApaLI GTGCAC 2 cut(s) 1020, 1566
ApoI RAATTY 2 cut(s) 427, 1309
AspS9I GGNCC 9 cut(s) 51, 115, 510, 998, 1110, 1237, 1544, 1656, 1783
AsuHPI GGTGA 6 cut(s) 768, 932, 1111, 1325, 1478, 1657
AsuNHI GCTAGC 1 cut(s) 1297
AvaI CYCGRG 1 cut(s) 30
AvaII GGWCC 5 cut(s) 115, 998, 1110, 1544, 1656
BaeGI GKGCMC 2 cut(s) 1024, 1570
BalI TGGCCA 2 cut(s) 372, 772
BanII GRGCYC 3 cut(s) 547, 1256, 1802
BauI CACGAG 1 cut(s) 609
BbsI GAAGAC 1 cut(s) 1863
Bbv12I GWGCWC 2 cut(s) 1024, 1570
BccI CCATC 6 cut(s) 458, 781, 901, 1285, 1338, 1447
BceAI ACGGC 2 cut(s) 38, 114
BciT130I CCWGG 2 cut(s) 582, 698
BciVI GTATCC 1 cut(s) 563
BcoDI GTCTC 4 cut(s) 872, 889, 1320, 1435
BcuI ACTAGT 2 cut(s) 1126, 1672
BfaI CTAG 3 cut(s) 1127, 1298, 1673
BfmI CTRYAG 2 cut(s) 1083, 1629
BfuI GTATCC 1 cut(s) 563
BglI GCCNNNNNGGC 2 cut(s) 938, 1484
Bme1390I CCNGG 2 cut(s) 582, 698
Bme18I GGWCC 5 cut(s) 115, 998, 1110, 1544, 1656
BmeT110I CYCGRG 1 cut(s) 30
BmgT120I GGNCC 9 cut(s) 51, 115, 510, 998, 1110, 1237, 1544, 1656, 1783
BmiI GGNNCC 1 cut(s) 52
BmrFI CCNGG 2 cut(s) 582, 698
BmrI ACTGGG 1 cut(s) 99
BmsI GCATC 2 cut(s) 1125, 1671
BmtI GCTAGC 1 cut(s) 1301
BmuI ACTGGG 1 cut(s) 99
BpiI GAAGAC 1 cut(s) 1863
BplI GAGNNNNNCTC 4 cut(s) 869, 901, 1415, 1447
BpuEI CTTGAG 1 cut(s) 1337
BsaBI GATNNNNATC 2 cut(s) 951, 1497
BsaI GGTCTC 1 cut(s) 1320
BsaJI CCNNGG 6 cut(s) 29, 54, 130, 580, 1187, 1733
BsaWI WCCGGW 1 cut(s) 214
Bsc4I CCNNNNNNNGG 3 cut(s) 697, 1107, 1653
Bse1I ACTGG 4 cut(s) 105, 568, 976, 1522
Bse3DI GCAATG 5 cut(s) 267, 482, 1024, 1570, 1858
Bse8I GATNNNNATC 2 cut(s) 951, 1497
BseAI TCCGGA 1 cut(s) 214
BseBI CCWGG 2 cut(s) 582, 698
BseDI CCNNGG 6 cut(s) 29, 54, 130, 580, 1187, 1733
BseGI GGATG 2 cut(s) 223, 1296
BseJI GATNNNNATC 2 cut(s) 951, 1497
BseLI CCNNNNNNNGG 3 cut(s) 697, 1107, 1653
BseMI GCAATG 5 cut(s) 267, 482, 1024, 1570, 1858
BseMII CTCAG 3 cut(s) 5, 927, 1473
BseNI ACTGG 4 cut(s) 105, 568, 976, 1522
BseRI GAGGAG 1 cut(s) 1334
BseSI GKGCMC 2 cut(s) 1024, 1570
Bsh1236I CGCG 1 cut(s) 734
BshFI GGCC 9 cut(s) 53, 129, 372, 512, 772, 1148, 1239, 1694, 1785
BsiHKAI GWGCWC 2 cut(s) 1024, 1570
BsiHKCI CYCGRG 1 cut(s) 30
BsiSI CCGG 1 cut(s) 215
BslFI GGGAC 5 cut(s) 80, 1073, 1161, 1619, 1707
BslI CCNNNNNNNGG 3 cut(s) 697, 1107, 1653
BsmAI GTCTC 4 cut(s) 872, 889, 1320, 1435
BsmFI GGGAC 5 cut(s) 80, 1073, 1161, 1619, 1707
BsmI GAATGC 3 cut(s) 904, 1450, 1853
BsnI GGCC 9 cut(s) 53, 129, 372, 512, 772, 1148, 1239, 1694, 1785
Bso31I GGTCTC 1 cut(s) 1320
BsoBI CYCGRG 1 cut(s) 30
Bsp1286I GDGCHC 5 cut(s) 547, 1024, 1256, 1570, 1802
Bsp13I TCCGGA 1 cut(s) 214
Bsp143I GATC 5 cut(s) 174, 199, 658, 952, 1498
BspACI CCGC 8 cut(s) 21, 245, 402, 405, 540, 656, 732, 1336
BspANI GGCC 9 cut(s) 53, 129, 372, 512, 772, 1148, 1239, 1694, 1785
BspCNI CTCAG 3 cut(s) 6, 928, 1474
BspEI TCCGGA 1 cut(s) 214
BspFNI CGCG 1 cut(s) 734
BspLI GGNNCC 1 cut(s) 52
BspOI GCTAGC 1 cut(s) 1301
BspPI GGATC 4 cut(s) 207, 666, 960, 1506
BspTNI GGTCTC 1 cut(s) 1320
BsrBI CCGCTC 1 cut(s) 656
BsrDI GCAATG 5 cut(s) 267, 482, 1024, 1570, 1858
BsrI ACTGG 4 cut(s) 105, 568, 976, 1522
BssECI CCNNGG 6 cut(s) 29, 54, 130, 580, 1187, 1733
BssMI GATC 5 cut(s) 174, 199, 658, 952, 1498
BssSI CACGAG 1 cut(s) 609
BssT1I CCWWGG 2 cut(s) 1187, 1733
Bst2BI CACGAG 1 cut(s) 609
Bst2UI CCWGG 2 cut(s) 582, 698
Bst4CI ACNGT 4 cut(s) 421, 883, 1087, 1633
BstAPI GCANNNNNTGC 1 cut(s) 611
BstC8I GCNNGC 5 cut(s) 137, 280, 350, 645, 1299
BstDEI CTNAG 3 cut(s) 14, 936, 1482
BstDSI CCRYGG 2 cut(s) 54, 130
BstF5I GGATG 2 cut(s) 223, 1296
BstFNI CGCG 1 cut(s) 734
BstKTI GATC 5 cut(s) 177, 202, 661, 955, 1501
BstMAI GTCTC 4 cut(s) 872, 889, 1320, 1435
BstMBI GATC 5 cut(s) 174, 199, 658, 952, 1498
BstNI CCWGG 2 cut(s) 582, 698
BstNSI RCATGY 4 cut(s) 155, 282, 527, 729
BstSCI CCNGG 2 cut(s) 580, 696
BstSFI CTRYAG 2 cut(s) 1083, 1629
BstSLI GKGCMC 2 cut(s) 1024, 1570
BstUI CGCG 1 cut(s) 734
BstV2I GAAGAC 1 cut(s) 1863
BstX2I RGATCY 2 cut(s) 952, 1498
BstXI CCANNNNNNTGG 2 cut(s) 112, 196
BstYI RGATCY 2 cut(s) 952, 1498
BsuI GTATCC 1 cut(s) 563
BsuRI GGCC 9 cut(s) 53, 129, 372, 512, 772, 1148, 1239, 1694, 1785
BtgI CCRYGG 2 cut(s) 54, 130
BtsCI GGATG 2 cut(s) 223, 1296
BtsI GCAGTG 1 cut(s) 1345
BtsIMutI CAGTG 5 cut(s) 112, 417, 1219, 1345, 1765
Cac8I GCNNGC 5 cut(s) 137, 280, 350, 645, 1299
CaiI CAGNNNCTG 3 cut(s) 13, 1091, 1637
Cfr13I GGNCC 9 cut(s) 51, 115, 510, 998, 1110, 1237, 1544, 1656, 1783
CseI GACGC 1 cut(s) 619
CsiI ACCWGGT 1 cut(s) 696
CspCI CAANNNNNGTGG 2 cut(s) 403, 438
DdeI CTNAG 3 cut(s) 14, 936, 1482
DpnI GATC 5 cut(s) 176, 201, 660, 954, 1500
DpnII GATC 5 cut(s) 174, 199, 658, 952, 1498
DrdI GACNNNNNNGTC 2 cut(s) 1005, 1551
DseDI GACNNNNNNGTC 2 cut(s) 1005, 1551
EaeI YGGCCR 2 cut(s) 370, 770
EciI GGCGGA 1 cut(s) 391
Eco130I CCWWGG 2 cut(s) 1187, 1733
Eco24I GRGCYC 3 cut(s) 547, 1256, 1802
Eco31I GGTCTC 1 cut(s) 1320
Eco47I GGWCC 5 cut(s) 115, 998, 1110, 1544, 1656
Eco57I CTGAAG 1 cut(s) 728
Eco88I CYCGRG 1 cut(s) 30
EcoO109I RGGNCCY 2 cut(s) 1237, 1783
EcoRII CCWGG 2 cut(s) 580, 696
EcoT14I CCWWGG 2 cut(s) 1187, 1733
EcoT22I ATGCAT 2 cut(s) 153, 267
EcoT38I GRGCYC 3 cut(s) 547, 1256, 1802
ErhI CCWWGG 2 cut(s) 1187, 1733
FaqI GGGAC 5 cut(s) 80, 1073, 1161, 1619, 1707
FauI CCCGC 1 cut(s) 533
FauNDI CATATG 2 cut(s) 965, 1511
FokI GGATG 2 cut(s) 230, 1303
FriOI GRGCYC 3 cut(s) 547, 1256, 1802
FspBI CTAG 3 cut(s) 1127, 1298, 1673
HaeIII GGCC 9 cut(s) 53, 129, 372, 512, 772, 1148, 1239, 1694, 1785
HapII CCGG 1 cut(s) 215
HgaI GACGC 1 cut(s) 619
HindIII AAGCTT 3 cut(s) 137, 816, 1362
HinfI GANTC 9 cut(s) 226, 241, 326, 674, 687, 842, 1174, 1388, 1720
HpaII CCGG 1 cut(s) 215
HphI GGTGA 6 cut(s) 768, 932, 1111, 1325, 1478, 1657
Hpy166II GTNNAC 3 cut(s) 1022, 1343, 1568
Hpy8I GTNNAC 3 cut(s) 1022, 1343, 1568
HpyAV CCTTC 9 cut(s) 756, 823, 868, 1211, 1281, 1369, 1414, 1757, 1827
HpyCH4III ACNGT 4 cut(s) 421, 883, 1087, 1633
HpyF3I CTNAG 3 cut(s) 14, 936, 1482
Kpn2I TCCGGA 1 cut(s) 214
Kzo9I GATC 5 cut(s) 174, 199, 658, 952, 1498
LmnI GCTCC 5 cut(s) 305, 473, 653, 1294, 1321
LweI GCATC 2 cut(s) 1125, 1671
MabI ACCWGGT 1 cut(s) 696
MaeI CTAG 3 cut(s) 1127, 1298, 1673
MalI GATC 5 cut(s) 176, 201, 660, 954, 1500
MbiI CCGCTC 1 cut(s) 656
MboI GATC 5 cut(s) 174, 199, 658, 952, 1498
MboII GAAGA 4 cut(s) 351, 1275, 1821, 1868
MfeI CAATTG 2 cut(s) 987, 1533
MflI RGATCY 2 cut(s) 952, 1498
MhlI GDGCHC 5 cut(s) 547, 1024, 1256, 1570, 1802
MlsI TGGCCA 2 cut(s) 372, 772
MluCI AATT 7 cut(s) 427, 668, 987, 1279, 1309, 1533, 1825
MluNI TGGCCA 2 cut(s) 372, 772
MlyI GAGTC 4 cut(s) 235, 668, 1183, 1729
MmeI TCCRAC 6 cut(s) 804, 976, 1088, 1350, 1522, 1634
Mox20I TGGCCA 2 cut(s) 372, 772
Mph1103I ATGCAT 2 cut(s) 153, 267
MroI TCCGGA 1 cut(s) 214
MscI TGGCCA 2 cut(s) 372, 772
MseI TTAA 5 cut(s) 332, 801, 836, 1347, 1382
MslI CAYNNNNRTG 3 cut(s) 909, 1338, 1455
Msp20I TGGCCA 2 cut(s) 372, 772
MspA1I CMGCKG 1 cut(s) 247
MspI CCGG 1 cut(s) 215
MspR9I CCNGG 2 cut(s) 582, 698
MunI CAATTG 2 cut(s) 987, 1533
Mva1269I GAATGC 3 cut(s) 904, 1450, 1853
MvaI CCWGG 2 cut(s) 582, 698
MvnI CGCG 1 cut(s) 734
NdeI CATATG 2 cut(s) 965, 1511
NdeII GATC 5 cut(s) 174, 199, 658, 952, 1498
NheI GCTAGC 1 cut(s) 1297
NlaIV GGNNCC 1 cut(s) 52
NmeAIII GCCGAG 1 cut(s) 538
NsiI ATGCAT 2 cut(s) 153, 267
NspI RCATGY 4 cut(s) 155, 282, 527, 729
OliI CACNNNNGTG 1 cut(s) 1338
PaeI GCATGC 1 cut(s) 282
PctI GAATGC 3 cut(s) 904, 1450, 1853
PfeI GAWTC 5 cut(s) 226, 326, 687, 842, 1388
PleI GAGTC 4 cut(s) 235, 668, 1182, 1728
PpsI GAGTC 4 cut(s) 235, 668, 1182, 1728
Psp6I CCWGG 2 cut(s) 580, 696
PspGI CCWGG 2 cut(s) 580, 696
PspN4I GGNNCC 1 cut(s) 52
PspPI GGNCC 9 cut(s) 51, 115, 510, 998, 1110, 1237, 1544, 1656, 1783
PstNI CAGNNNCTG 3 cut(s) 13, 1091, 1637
PsuI RGATCY 2 cut(s) 952, 1498
RseI CAYNNNNRTG 3 cut(s) 909, 1338, 1455
SaqAI TTAA 5 cut(s) 332, 801, 836, 1347, 1382
Sau3AI GATC 5 cut(s) 174, 199, 658, 952, 1498
Sau96I GGNCC 9 cut(s) 51, 115, 510, 998, 1110, 1237, 1544, 1656, 1783
SchI GAGTC 4 cut(s) 235, 668, 1183, 1729
ScrFI CCNGG 2 cut(s) 582, 698
SduI GDGCHC 5 cut(s) 547, 1024, 1256, 1570, 1802
SexAI ACCWGGT 1 cut(s) 696
SfaNI GCATC 2 cut(s) 1125, 1671
SfcI CTRYAG 2 cut(s) 1083, 1629
SinI GGWCC 5 cut(s) 115, 998, 1110, 1544, 1656
SmiMI CAYNNNNRTG 3 cut(s) 909, 1338, 1455
SmlI CTYRAG 1 cut(s) 1316
SmoI CTYRAG 1 cut(s) 1316
SpeI ACTAGT 2 cut(s) 1126, 1672
SphI GCATGC 1 cut(s) 282
Sse9I AATT 7 cut(s) 427, 668, 987, 1279, 1309, 1533, 1825
SsiI CCGC 8 cut(s) 21, 245, 402, 405, 540, 656, 732, 1336
SspI AATATT 1 cut(s) 457
SspMI CTAG 3 cut(s) 1127, 1298, 1673
StyD4I CCNGG 2 cut(s) 580, 696
StyI CCWWGG 2 cut(s) 1187, 1733
TaaI ACNGT 4 cut(s) 421, 883, 1087, 1633
TaqI TCGA 2 cut(s) 177, 324
TaqII GACCGA 1 cut(s) 192
TasI AATT 7 cut(s) 427, 668, 987, 1279, 1309, 1533, 1825
TauI GCSGC 2 cut(s) 407, 734
TfiI GAWTC 5 cut(s) 226, 326, 687, 842, 1388
Tru1I TTAA 5 cut(s) 332, 801, 836, 1347, 1382
Tru9I TTAA 5 cut(s) 332, 801, 836, 1347, 1382
TscAI CASTG 5 cut(s) 112, 424, 1219, 1345, 1765
TspDTI ATGAA 3 cut(s) 587, 738, 1869
TspRI CASTG 5 cut(s) 112, 424, 1219, 1345, 1765
VneI GTGCAC 2 cut(s) 1020, 1566
VpaK11BI GGWCC 5 cut(s) 115, 998, 1110, 1544, 1656
XapI RAATTY 2 cut(s) 427, 1309
XceI RCATGY 4 cut(s) 155, 282, 527, 729
XcmI CCANNNNNNNNNTGG 2 cut(s) 1156, 1702
XspI CTAG 3 cut(s) 1127, 1298, 1673
Zsp2I ATGCAT 2 cut(s) 153, 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.