Rmu_sc0011657.1_g000008

acyl-activating enzyme

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011657.1
OG0001616
Physical Location & Seq
Forward (+)
26319 .. 27040
722 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011657.1_g000008.1.cds

Sequence Viewer

Length: 291 bp
atgggtggtggagagtctgtgacaatgagtgatggagagcagcgcaagagtgagaaagagaggctgttctgttatgtaatgtacacttcgagctcgacgagcaagccgaaaggtatttgtggaactgaacaaggtctttggaatcggtttcggtggatgcaagaattgtatccattgaatggagaggaggtccctccgtcgggattccgtcaatttcagccgttaattgctgacgtggcagtccaactcagcaaaagtgggacccacatgaaagccaaataccgaaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AMP-binding AMP-binding_C PP-binding PQQ PQQ_2 PQQ_3

Protein Analysis

96

Amino Acids

10.9

Weight (kDa)

9.23

Isoelectric Point (pI)

48.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 239
AccB7I CCANNNNNTGG 1 cut(s) 179
AfaI GTAC 1 cut(s) 83
AfiI CCNNNNNNNGG 3 cut(s) 179, 199, 200
AgsI TTSAA 1 cut(s) 178
AjiI CACGTC 1 cut(s) 235
AluBI AGCT 1 cut(s) 93
AluI AGCT 1 cut(s) 93
Alw21I GWGCWC 1 cut(s) 95
ApeKI GCWGC 1 cut(s) 40
AspLEI GCGC 1 cut(s) 45
AspS9I GGNCC 2 cut(s) 190, 261
AvaII GGWCC 2 cut(s) 190, 261
BanII GRGCYC 1 cut(s) 95
Bbv12I GWGCWC 1 cut(s) 95
BbvI GCAGC 1 cut(s) 52
BccI CCATC 1 cut(s) 26
BceAI ACGGC 1 cut(s) 205
BciVI GTATCC 1 cut(s) 180
BfuI GTATCC 1 cut(s) 180
BisI GCNGC 1 cut(s) 41
BlsI GCNGC 1 cut(s) 42
Bme18I GGWCC 2 cut(s) 190, 261
BmgBI CACGTC 1 cut(s) 235
BmgT120I GGNCC 2 cut(s) 190, 261
BmiI GGNNCC 3 cut(s) 192, 262, 263
BmsI GCATC 1 cut(s) 147
BsaXI ACNNNNNCTCC 3 cut(s) 33, 174, 204
Bsc4I CCNNNNNNNGG 3 cut(s) 179, 199, 200
BseGI GGATG 1 cut(s) 162
BseLI CCNNNNNNNGG 3 cut(s) 179, 199, 200
BseMII CTCAG 1 cut(s) 262
BseRI GAGGAG 1 cut(s) 200
BseXI GCAGC 1 cut(s) 52
BsiHKAI GWGCWC 1 cut(s) 95
BslFI GGGAC 2 cut(s) 176, 274
BslI CCNNNNNNNGG 3 cut(s) 179, 199, 200
BsmFI GGGAC 2 cut(s) 176, 274
Bsp1286I GDGCHC 1 cut(s) 95
Bsp1407I TGTACA 1 cut(s) 81
BspCNI CTCAG 1 cut(s) 261
BspLI GGNNCC 3 cut(s) 192, 262, 263
BsrGI TGTACA 1 cut(s) 81
BstAUI TGTACA 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 104
BstDEI CTNAG 1 cut(s) 248
BstF5I GGATG 1 cut(s) 162
BstHHI GCGC 1 cut(s) 45
BstMWI GCNNNNNNNGC 2 cut(s) 99, 236
BstV1I GCAGC 1 cut(s) 52
BsuI GTATCC 1 cut(s) 180
BtrI CACGTC 1 cut(s) 235
BtsCI GGATG 1 cut(s) 162
Cac8I GCNNGC 1 cut(s) 104
CfoI GCGC 1 cut(s) 45
Cfr13I GGNCC 2 cut(s) 190, 261
Csp6I GTAC 1 cut(s) 82
CviAII CATG 1 cut(s) 268
CviJI RGCY 5 cut(s) 64, 93, 106, 220, 275
CviKI_1 RGCY 5 cut(s) 64, 93, 106, 220, 275
CviQI GTAC 1 cut(s) 82
DdeI CTNAG 1 cut(s) 248
DrdI GACNNNNNNGTC 1 cut(s) 239
DseDI GACNNNNNNGTC 1 cut(s) 239
Ecl136II GAGCTC 1 cut(s) 93
Eco24I GRGCYC 1 cut(s) 95
Eco47I GGWCC 2 cut(s) 190, 261
Eco53kI GAGCTC 1 cut(s) 93
EcoICRI GAGCTC 1 cut(s) 93
EcoO109I RGGNCCY 2 cut(s) 190, 261
EcoT38I GRGCYC 1 cut(s) 95
FaeI CATG 1 cut(s) 271
FaiI YATR 2 cut(s) 75, 269
FaqI GGGAC 2 cut(s) 176, 274
FatI CATG 1 cut(s) 267
Fnu4HI GCNGC 1 cut(s) 41
FokI GGATG 1 cut(s) 169
FriOI GRGCYC 1 cut(s) 95
Fsp4HI GCNGC 1 cut(s) 41
GlaI GCGC 1 cut(s) 44
GluI GCNGC 1 cut(s) 41
HhaI GCGC 1 cut(s) 45
Hin1II CATG 1 cut(s) 271
Hin6I GCGC 1 cut(s) 43
HinP1I GCGC 1 cut(s) 43
HinfI GANTC 3 cut(s) 14, 142, 204
Hpy166II GTNNAC 1 cut(s) 84
Hpy188III TCNNGA 1 cut(s) 201
Hpy8I GTNNAC 1 cut(s) 84
Hpy99I CGWCG 2 cut(s) 100, 202
HpyCH4IV ACGT 1 cut(s) 234
HpyCH4V TGCA 1 cut(s) 160
HpyF10VI GCNNNNNNNGC 2 cut(s) 99, 236
HpyF3I CTNAG 1 cut(s) 248
HpySE526I ACGT 1 cut(s) 234
Hsp92II CATG 1 cut(s) 271
HspAI GCGC 1 cut(s) 43
KflI GGGWCCC 1 cut(s) 261
Lsp1109I GCAGC 1 cut(s) 52
LweI GCATC 1 cut(s) 147
MaeII ACGT 1 cut(s) 234
MaeIII GTNAC 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 95
MluCI AATT 3 cut(s) 164, 212, 225
MlyI GAGTC 1 cut(s) 23
MmeI TCCRAC 1 cut(s) 268
MnlI CCTC 4 cut(s) 54, 178, 181, 204
MseI TTAA 1 cut(s) 224
MwoI GCNNNNNNNGC 2 cut(s) 99, 236
NlaIII CATG 1 cut(s) 271
NlaIV GGNNCC 3 cut(s) 192, 262, 263
NmuCI GTSAC 1 cut(s) 19
PcsI WCGNNNNNNNCGW 2 cut(s) 95, 104
PfeI GAWTC 2 cut(s) 142, 204
PflMI CCANNNNNTGG 1 cut(s) 179
PkrI GCNGC 1 cut(s) 42
PleI GAGTC 1 cut(s) 22
PpsI GAGTC 1 cut(s) 22
PpuMI RGGWCCY 2 cut(s) 190, 261
Psp124BI GAGCTC 1 cut(s) 95
Psp5II RGGWCCY 2 cut(s) 190, 261
PspN4I GGNNCC 3 cut(s) 192, 262, 263
PspPI GGNCC 2 cut(s) 190, 261
PspPPI RGGWCCY 2 cut(s) 190, 261
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
SacI GAGCTC 1 cut(s) 95
SaqAI TTAA 1 cut(s) 224
SatI GCNGC 1 cut(s) 41
Sau96I GGNCC 2 cut(s) 190, 261
SchI GAGTC 1 cut(s) 23
SduI GDGCHC 1 cut(s) 95
SetI ASST 5 cut(s) 95, 115, 136, 192, 237
SfaNI GCATC 1 cut(s) 147
SinI GGWCC 2 cut(s) 190, 261
Sse9I AATT 3 cut(s) 164, 212, 225
SstI GAGCTC 1 cut(s) 95
TaiI ACGT 1 cut(s) 237
TaqI TCGA 2 cut(s) 89, 95
TasI AATT 3 cut(s) 164, 212, 225
TatI WGTACW 1 cut(s) 81
TfiI GAWTC 2 cut(s) 142, 204
Tru1I TTAA 1 cut(s) 224
Tru9I TTAA 1 cut(s) 224
TseFI GTSAC 1 cut(s) 19
TseI GCWGC 1 cut(s) 40
Tsp45I GTSAC 1 cut(s) 19
TspDTI ATGAA 1 cut(s) 284
TspGWI ACGGA 2 cut(s) 186, 197
Van91I CCANNNNNTGG 1 cut(s) 179
VpaK11BI GGWCC 2 cut(s) 190, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.