Rmu_sc0017524.1_g000002

Salutaridine reductase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017524.1
Physical Location & Seq
Forward (+)
7135 .. 7443
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017524.1_g000002.1.cds

Sequence Viewer

Length: 309 bp
ctggttgaggaatttctggaggatgtgaagcaggatttgatagaatccaaaggctggcctctaaacatgtcttcttacattgtatcaaaagcagctctgaatgcttatacaagagtcttggccaagaagtatcccaaaattgctacaaacgcagttagtcctggttttaccaaaacagacatcaaccaaaataccggtattaacacagttgaagaagctgcagaaggtcctgtgaagctggctttaatagctgactctggtatttctggcctctactttgaaatgacggaagaatcatcctttgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.13

Weight (kDa)

4.57

Isoelectric Point (pI)

43.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 54
AcoI YGGCCR 1 cut(s) 120
AcsI RAATTY 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 54
AflIII ACRYGT 1 cut(s) 66
AgeI ACCGGT 1 cut(s) 194
AgsI TTSAA 2 cut(s) 212, 281
AjnI CCWGG 1 cut(s) 160
AluBI AGCT 4 cut(s) 95, 218, 238, 251
AluI AGCT 4 cut(s) 95, 218, 238, 251
AoxI GGCC 3 cut(s) 56, 120, 268
ApeKI GCWGC 2 cut(s) 92, 218
ApoI RAATTY 1 cut(s) 11
AsiGI ACCGGT 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 227
AvaII GGWCC 1 cut(s) 227
BalI TGGCCA 1 cut(s) 122
BbsI GAAGAC 1 cut(s) 63
BbvI GCAGC 2 cut(s) 104, 205
BciT130I CCWGG 1 cut(s) 162
BciVI GTATCC 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 219
BfuI GTATCC 1 cut(s) 141
BisI GCNGC 2 cut(s) 93, 219
BlsI GCNGC 2 cut(s) 94, 220
Bme1390I CCNGG 1 cut(s) 162
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 1 cut(s) 227
BmrFI CCNGG 1 cut(s) 162
BpiI GAAGAC 1 cut(s) 63
BpmI CTGGAG 1 cut(s) 38
BsaWI WCCGGW 1 cut(s) 194
Bsc4I CCNNNNNNNGG 1 cut(s) 54
Bse118I RCCGGY 1 cut(s) 194
BseBI CCWGG 1 cut(s) 162
BseGI GGATG 2 cut(s) 28, 296
BseLI CCNNNNNNNGG 1 cut(s) 54
BseXI GCAGC 2 cut(s) 104, 205
BshFI GGCC 3 cut(s) 58, 122, 270
BshTI ACCGGT 1 cut(s) 194
BsiSI CCGG 1 cut(s) 195
BslI CCNNNNNNNGG 1 cut(s) 54
BsmI GAATGC 1 cut(s) 106
BsnI GGCC 3 cut(s) 58, 122, 270
BspANI GGCC 3 cut(s) 58, 122, 270
BspMAI CTGCAG 1 cut(s) 223
BsrFI RCCGGY 1 cut(s) 194
BssAI RCCGGY 1 cut(s) 194
Bst2UI CCWGG 1 cut(s) 162
Bst4CI ACNGT 1 cut(s) 208
BstC8I GCNNGC 2 cut(s) 56, 240
BstF5I GGATG 2 cut(s) 28, 296
BstMWI GCNNNNNNNGC 3 cut(s) 101, 149, 248
BstNI CCWGG 1 cut(s) 162
BstNSI RCATGY 1 cut(s) 70
BstSCI CCNGG 1 cut(s) 160
BstSFI CTRYAG 1 cut(s) 219
BstV1I GCAGC 2 cut(s) 104, 205
BstV2I GAAGAC 1 cut(s) 63
BsuI GTATCC 1 cut(s) 141
BsuRI GGCC 3 cut(s) 58, 122, 270
BtsCI GGATG 2 cut(s) 28, 296
Cac8I GCNNGC 2 cut(s) 56, 240
Cfr10I RCCGGY 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 227
CspAI ACCGGT 1 cut(s) 194
CviAII CATG 1 cut(s) 67
CviJI RGCY 9 cut(s) 54, 58, 95, 122, 218, 238, 242, 251, 270
CviKI_1 RGCY 9 cut(s) 54, 58, 95, 122, 218, 238, 242, 251, 270
EaeI YGGCCR 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 227
EcoO109I RGGNCCY 1 cut(s) 227
EcoRII CCWGG 1 cut(s) 160
FaeI CATG 1 cut(s) 70
FaiI YATR 2 cut(s) 68, 108
FatI CATG 1 cut(s) 66
Fnu4HI GCNGC 2 cut(s) 93, 219
FokI GGATG 2 cut(s) 35, 283
Fsp4HI GCNGC 2 cut(s) 93, 219
GluI GCNGC 2 cut(s) 93, 219
GsuI CTGGAG 1 cut(s) 38
HaeIII GGCC 3 cut(s) 58, 122, 270
HapII CCGG 1 cut(s) 195
Hin1II CATG 1 cut(s) 70
HinfI GANTC 4 cut(s) 44, 114, 254, 293
HpaII CCGG 1 cut(s) 195
Hpy188I TCNGA 1 cut(s) 99
Hpy188III TCNNGA 1 cut(s) 17
HpyAV CCTTC 1 cut(s) 218
HpyCH4III ACNGT 1 cut(s) 208
HpyCH4V TGCA 1 cut(s) 221
HpyF10VI GCNNNNNNNGC 3 cut(s) 101, 149, 248
Hsp92II CATG 1 cut(s) 70
Lsp1109I GCAGC 2 cut(s) 104, 205
MboII GAAGA 3 cut(s) 63, 224, 302
MlsI TGGCCA 1 cut(s) 122
MluCI AATT 2 cut(s) 11, 138
MluNI TGGCCA 1 cut(s) 122
MlyI GAGTC 2 cut(s) 123, 248
MnlI CCTC 3 cut(s) 13, 69, 281
Mox20I TGGCCA 1 cut(s) 122
MscI TGGCCA 1 cut(s) 122
MseI TTAA 2 cut(s) 201, 245
Msp20I TGGCCA 1 cut(s) 122
MspI CCGG 1 cut(s) 195
MspR9I CCNGG 1 cut(s) 162
Mva1269I GAATGC 1 cut(s) 106
MvaI CCWGG 1 cut(s) 162
MwoI GCNNNNNNNGC 3 cut(s) 101, 149, 248
NlaIII CATG 1 cut(s) 70
NspI RCATGY 1 cut(s) 70
PciI ACATGT 1 cut(s) 66
PctI GAATGC 1 cut(s) 106
PfeI GAWTC 2 cut(s) 44, 293
PflMI CCANNNNNTGG 1 cut(s) 54
PinAI ACCGGT 1 cut(s) 194
PkrI GCNGC 2 cut(s) 94, 220
PleI GAGTC 2 cut(s) 122, 248
PpsI GAGTC 2 cut(s) 122, 248
PpuMI RGGWCCY 1 cut(s) 227
PscI ACATGT 1 cut(s) 66
Psp5II RGGWCCY 1 cut(s) 227
Psp6I CCWGG 1 cut(s) 160
PspGI CCWGG 1 cut(s) 160
PspPI GGNCC 1 cut(s) 227
PspPPI RGGWCCY 1 cut(s) 227
PstI CTGCAG 1 cut(s) 223
SaqAI TTAA 2 cut(s) 201, 245
SatI GCNGC 2 cut(s) 93, 219
Sau96I GGNCC 1 cut(s) 227
SchI GAGTC 2 cut(s) 123, 248
ScrFI CCNGG 1 cut(s) 162
SetI ASST 5 cut(s) 97, 220, 229, 240, 253
SfcI CTRYAG 1 cut(s) 219
SinI GGWCC 1 cut(s) 227
Sse9I AATT 2 cut(s) 11, 138
StyD4I CCNGG 1 cut(s) 160
TaaI ACNGT 1 cut(s) 208
TasI AATT 2 cut(s) 11, 138
TfiI GAWTC 2 cut(s) 44, 293
Tru1I TTAA 2 cut(s) 201, 245
Tru9I TTAA 2 cut(s) 201, 245
TseI GCWGC 2 cut(s) 92, 218
TspGWI ACGGA 1 cut(s) 302
Van91I CCANNNNNTGG 1 cut(s) 54
VpaK11BI GGWCC 1 cut(s) 227
XapI RAATTY 1 cut(s) 11
XceI RCATGY 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.