Rh7DG269000

Salutaridine reductase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0001077
Physical Location & Seq
Forward (+)
28724616 .. 28725385
770 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG269000.1

Sequence Viewer

Length: 357 bp
ATGGACACTAGAAAGATCTCAAACACAAACAATTCTATTATTCATTGTGAACCATCATCTACATTCGTAAAGCACACACATACCTTTTCTCCAAATCTGTATAACAAATGGCAGAAACAACCATCAGTTTTGGGTCCAAGAGCTCTGAATGCTTATACAAGAGTCTTGGCAAAGAAGTATCCTGAAATTGCTACAAACGCAGTTAGTCCTGGCTTTACCAAAACAGATATCAACCAAAATACTGGGATTAACACAGTTGAAGAAGGTGCAGAAGGTCCTGTGAAGCTGGCTTTGATAGCTGACACTGGAATTTCTGGCCTCTACTTCGAAATGACTGAAGAGTCAACCTTTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00902 ko01110 map00902 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

118

Amino Acids

13.02

Weight (kDa)

6.28

Isoelectric Point (pI)

32.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 340
AcsI RAATTY 1 cut(s) 309
AcuI CTGAAG 1 cut(s) 357
AgsI TTSAA 1 cut(s) 260
AjnI CCWGG 1 cut(s) 208
AluBI AGCT 3 cut(s) 143, 286, 299
AluI AGCT 3 cut(s) 143, 286, 299
Alw21I GWGCWC 1 cut(s) 145
AoxI GGCC 1 cut(s) 316
ApoI RAATTY 1 cut(s) 309
AspS9I GGNCC 2 cut(s) 134, 275
AsuII TTCGAA 1 cut(s) 327
AvaII GGWCC 2 cut(s) 134, 275
BanII GRGCYC 1 cut(s) 145
Bbv12I GWGCWC 1 cut(s) 145
BccI CCATC 2 cut(s) 61, 130
BciT130I CCWGG 1 cut(s) 210
BciVI GTATCC 1 cut(s) 189
BfaI CTAG 1 cut(s) 9
BfuI GTATCC 1 cut(s) 189
BglII AGATCT 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 210
Bme18I GGWCC 2 cut(s) 134, 275
BmgT120I GGNCC 2 cut(s) 134, 275
BmiI GGNNCC 1 cut(s) 135
BmrFI CCNGG 1 cut(s) 210
BmrI ACTGGG 1 cut(s) 252
BmuI ACTGGG 1 cut(s) 252
Bpu14I TTCGAA 1 cut(s) 327
BsaXI ACNNNNNCTCC 2 cut(s) 73, 103
Bse1I ACTGG 2 cut(s) 247, 310
BseBI CCWGG 1 cut(s) 210
BseNI ACTGG 2 cut(s) 247, 310
BsgI GTGCAG 1 cut(s) 288
BshFI GGCC 1 cut(s) 318
BsiHKAI GWGCWC 1 cut(s) 145
BsmI GAATGC 1 cut(s) 154
BsnI GGCC 1 cut(s) 318
Bsp119I TTCGAA 1 cut(s) 327
Bsp1286I GDGCHC 1 cut(s) 145
Bsp143I GATC 1 cut(s) 15
BspANI GGCC 1 cut(s) 318
BspLI GGNNCC 1 cut(s) 135
BspT104I TTCGAA 1 cut(s) 327
BsrI ACTGG 2 cut(s) 247, 310
BssMI GATC 1 cut(s) 15
Bst2UI CCWGG 1 cut(s) 210
Bst4CI ACNGT 1 cut(s) 256
Bst6I CTCTTC 1 cut(s) 333
BstBI TTCGAA 1 cut(s) 327
BstC8I GCNNGC 1 cut(s) 288
BstKTI GATC 1 cut(s) 18
BstMBI GATC 1 cut(s) 15
BstMWI GCNNNNNNNGC 3 cut(s) 149, 197, 296
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 208
BstX2I RGATCY 1 cut(s) 15
BstXI CCANNNNNNTGG 1 cut(s) 242
BstYI RGATCY 1 cut(s) 15
BsuI GTATCC 1 cut(s) 189
BsuRI GGCC 1 cut(s) 318
BtsIMutI CAGTG 1 cut(s) 303
Cac8I GCNNGC 1 cut(s) 288
Cfr13I GGNCC 2 cut(s) 134, 275
CviJI RGCY 6 cut(s) 143, 213, 286, 290, 299, 318
CviKI_1 RGCY 6 cut(s) 143, 213, 286, 290, 299, 318
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
DrdI GACNNNNNNGTC 1 cut(s) 340
DseDI GACNNNNNNGTC 1 cut(s) 340
Eam1104I CTCTTC 1 cut(s) 333
EarI CTCTTC 1 cut(s) 333
Ecl136II GAGCTC 1 cut(s) 143
Eco24I GRGCYC 1 cut(s) 145
Eco32I GATATC 1 cut(s) 229
Eco47I GGWCC 2 cut(s) 134, 275
Eco53kI GAGCTC 1 cut(s) 143
Eco57I CTGAAG 1 cut(s) 357
EcoICRI GAGCTC 1 cut(s) 143
EcoO109I RGGNCCY 1 cut(s) 275
EcoRII CCWGG 1 cut(s) 208
EcoRV GATATC 1 cut(s) 229
EcoT38I GRGCYC 1 cut(s) 145
FaiI YATR 3 cut(s) 81, 102, 156
FriOI GRGCYC 1 cut(s) 145
FspBI CTAG 1 cut(s) 9
HaeIII GGCC 1 cut(s) 318
HincII GTYRAC 1 cut(s) 345
HindII GTYRAC 1 cut(s) 345
HinfI GANTC 2 cut(s) 162, 341
Hpy166II GTNNAC 2 cut(s) 50, 345
Hpy188I TCNGA 1 cut(s) 147
Hpy188III TCNNGA 1 cut(s) 182
Hpy8I GTNNAC 2 cut(s) 50, 345
HpyAV CCTTC 2 cut(s) 257, 266
HpyCH4III ACNGT 1 cut(s) 256
HpyCH4V TGCA 1 cut(s) 269
HpyF10VI GCNNNNNNNGC 3 cut(s) 149, 197, 296
Kzo9I GATC 1 cut(s) 15
LpnPI CCDG 8 cut(s) 195, 195, 222, 228, 272, 291, 291, 300
MaeI CTAG 1 cut(s) 9
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MboII GAAGA 2 cut(s) 272, 350
MflI RGATCY 1 cut(s) 15
MhlI GDGCHC 1 cut(s) 145
MluCI AATT 3 cut(s) 31, 186, 309
MlyI GAGTC 2 cut(s) 171, 350
MnlI CCTC 1 cut(s) 329
MseI TTAA 1 cut(s) 249
MspR9I CCNGG 1 cut(s) 210
Mva1269I GAATGC 1 cut(s) 154
MvaI CCWGG 1 cut(s) 210
MwoI GCNNNNNNNGC 3 cut(s) 149, 197, 296
NdeII GATC 1 cut(s) 15
NlaIV GGNNCC 1 cut(s) 135
NspV TTCGAA 1 cut(s) 327
PctI GAATGC 1 cut(s) 154
PleI GAGTC 2 cut(s) 170, 349
PpsI GAGTC 2 cut(s) 170, 349
PpuMI RGGWCCY 1 cut(s) 275
Psp124BI GAGCTC 1 cut(s) 145
Psp5II RGGWCCY 1 cut(s) 275
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
PspN4I GGNNCC 1 cut(s) 135
PspPI GGNCC 2 cut(s) 134, 275
PspPPI RGGWCCY 1 cut(s) 275
PsuI RGATCY 1 cut(s) 15
SacI GAGCTC 1 cut(s) 145
SaqAI TTAA 1 cut(s) 249
Sau3AI GATC 1 cut(s) 15
Sau96I GGNCC 2 cut(s) 134, 275
SchI GAGTC 2 cut(s) 171, 350
ScrFI CCNGG 1 cut(s) 210
SduI GDGCHC 1 cut(s) 145
SetI ASST 7 cut(s) 86, 145, 268, 277, 288, 301, 350
SfuI TTCGAA 1 cut(s) 327
SinI GGWCC 2 cut(s) 134, 275
Sse9I AATT 3 cut(s) 31, 186, 309
SspMI CTAG 1 cut(s) 9
SstI GAGCTC 1 cut(s) 145
StyD4I CCNGG 1 cut(s) 208
TaaI ACNGT 1 cut(s) 256
TaqI TCGA 1 cut(s) 327
TasI AATT 3 cut(s) 31, 186, 309
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TscAI CASTG 1 cut(s) 310
TspDTI ATGAA 1 cut(s) 32
TspRI CASTG 1 cut(s) 310
VpaK11BI GGWCC 2 cut(s) 134, 275
XapI RAATTY 1 cut(s) 309
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.