Rmu_ssc0000465.1_g000024

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000465.1
Physical Location & Seq
Reverse (-)
103521 .. 104493
973 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000465.1_g000024.1.cds

Sequence Viewer

Length: 228 bp
atgccatacacgagagcaaaaaggtctgcttcaccacagacctctgtctcacctgtcaaaggccgacgatcgagatcattgtcgagagaatctcgtggatttgcatttgtcacaatggaaactgtagaggatgcagagcgatgcattaagtacttgaatcgttctgtgcttgaaggtcgactagtcactgtggaaaaggtatcagtttctgtcaaaggatcaagatag

Protein Analysis

75

Amino Acids

8.41

Weight (kDa)

10.9

Isoelectric Point (pI)

73.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 178
AclWI GGATC 1 cut(s) 226
AfaI GTAC 1 cut(s) 152
AfiI CCNNNNNNNGG 1 cut(s) 59
AgsI TTSAA 2 cut(s) 157, 173
AhlI ACTAGT 1 cut(s) 181
Alw26I GTCTC 1 cut(s) 52
AlwI GGATC 1 cut(s) 226
AlwNI CAGNNNCTG 1 cut(s) 209
AoxI GGCC 1 cut(s) 61
AsuHPI GGTGA 2 cut(s) 24, 42
BauI CACGAG 2 cut(s) 10, 93
BcoDI GTCTC 1 cut(s) 52
BcuI ACTAGT 1 cut(s) 181
BfaI CTAG 1 cut(s) 182
BfmI CTRYAG 1 cut(s) 123
BmcAI AGTACT 1 cut(s) 152
BmsI GCATC 2 cut(s) 121, 131
BoxI GACNNNNGTC 1 cut(s) 44
BplI GAGNNNNNCTC 2 cut(s) 76, 108
BsaBI GATNNNNATC 1 cut(s) 73
Bsc4I CCNNNNNNNGG 1 cut(s) 59
Bse8I GATNNNNATC 1 cut(s) 73
BseGI GGATG 1 cut(s) 136
BseJI GATNNNNATC 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 59
Bsh1285I CGRYCG 1 cut(s) 71
BshFI GGCC 1 cut(s) 63
BsiEI CGRYCG 1 cut(s) 71
BslI CCNNNNNNNGG 1 cut(s) 59
BsmAI GTCTC 1 cut(s) 52
BsnI GGCC 1 cut(s) 63
Bsp143I GATC 3 cut(s) 68, 74, 218
BspANI GGCC 1 cut(s) 63
BspPI GGATC 1 cut(s) 226
BssMI GATC 3 cut(s) 68, 74, 218
BssSI CACGAG 2 cut(s) 10, 93
Bst2BI CACGAG 2 cut(s) 10, 93
Bst4CI ACNGT 2 cut(s) 124, 190
BstENI CCTNNNNNAGG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 136
BstKTI GATC 3 cut(s) 71, 77, 221
BstMAI GTCTC 1 cut(s) 52
BstMBI GATC 3 cut(s) 68, 74, 218
BstMCI CGRYCG 1 cut(s) 71
BstPAI GACNNNNGTC 1 cut(s) 44
BstSFI CTRYAG 1 cut(s) 123
BsuRI GGCC 1 cut(s) 63
BtgZI GCGATG 1 cut(s) 154
BtsCI GGATG 1 cut(s) 136
BtsIMutI CAGTG 1 cut(s) 186
CaiI CAGNNNCTG 1 cut(s) 209
Csp6I GTAC 1 cut(s) 151
CviJI RGCY 1 cut(s) 63
CviKI_1 RGCY 1 cut(s) 63
CviQI GTAC 1 cut(s) 151
DpnI GATC 3 cut(s) 70, 76, 220
DpnII GATC 3 cut(s) 68, 74, 218
EcoNI CCTNNNNNAGG 1 cut(s) 57
EcoT22I ATGCAT 1 cut(s) 146
FaiI YATR 1 cut(s) 7
FalI AAGNNNNNCTT 2 cut(s) 13, 45
FblI GTMKAC 1 cut(s) 178
FokI GGATG 1 cut(s) 143
FspBI CTAG 1 cut(s) 182
HaeIII GGCC 1 cut(s) 63
HincII GTYRAC 1 cut(s) 179
HindII GTYRAC 1 cut(s) 179
HinfI GANTC 2 cut(s) 89, 157
HphI GGTGA 2 cut(s) 24, 42
Hpy166II GTNNAC 1 cut(s) 179
Hpy188III TCNNGA 3 cut(s) 72, 84, 222
Hpy8I GTNNAC 1 cut(s) 179
Hpy99I CGWCG 1 cut(s) 69
HpyAV CCTTC 1 cut(s) 167
HpyCH4III ACNGT 2 cut(s) 124, 190
HpyCH4V TGCA 3 cut(s) 104, 134, 144
Kzo9I GATC 3 cut(s) 68, 74, 218
LpnPI CCDG 1 cut(s) 66
LweI GCATC 2 cut(s) 121, 131
MaeI CTAG 1 cut(s) 182
MaeIII GTNAC 2 cut(s) 109, 184
MalI GATC 3 cut(s) 70, 76, 220
MboI GATC 3 cut(s) 68, 74, 218
MnlI CCTC 2 cut(s) 52, 121
Mph1103I ATGCAT 1 cut(s) 146
MseI TTAA 1 cut(s) 147
NdeII GATC 3 cut(s) 68, 74, 218
NmuCI GTSAC 2 cut(s) 109, 184
NsiI ATGCAT 1 cut(s) 146
PfeI GAWTC 2 cut(s) 89, 157
Ple19I CGATCG 1 cut(s) 71
PshAI GACNNNNGTC 1 cut(s) 44
PstNI CAGNNNCTG 1 cut(s) 209
PvuI CGATCG 1 cut(s) 71
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
SalI GTCGAC 1 cut(s) 177
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 3 cut(s) 68, 74, 218
ScaI AGTACT 1 cut(s) 152
SetI ASST 5 cut(s) 26, 44, 55, 178, 201
SfaNI GCATC 2 cut(s) 121, 131
SfcI CTRYAG 1 cut(s) 123
SpeI ACTAGT 1 cut(s) 181
SspMI CTAG 1 cut(s) 182
TaaI ACNGT 2 cut(s) 124, 190
TaqI TCGA 3 cut(s) 71, 83, 178
TatI WGTACW 1 cut(s) 150
TfiI GAWTC 2 cut(s) 89, 157
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 193
TseFI GTSAC 2 cut(s) 109, 184
Tsp45I GTSAC 2 cut(s) 109, 184
TspRI CASTG 1 cut(s) 193
XagI CCTNNNNNAGG 1 cut(s) 57
XmiI GTMKAC 1 cut(s) 178
XspI CTAG 1 cut(s) 182
ZrmI AGTACT 1 cut(s) 152
Zsp2I ATGCAT 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.