Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2D

Orthogroup ID

OG0001558

Physical Location & Seq

Genomic Coordinates Reverse (-)

10252468 .. 10253253

Gene Structure 786 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2DG123400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

ATGCCAAGCTTAAACAGCTTTTCAAATCCGCCTGATCAACTAAACATAGCAACTATATTCCAACAACTATACAACTTCAGCATTCACTTTCAACTTTCATCTCAACTAATCAACGGACATTACCAACAACTTTCTAATCAAGCCTTTATGTCCCGGAGGAAGCGACCAAGGACTCCGACACCTGGGCATTATCTCGGATTGAAAAATACTAGGGACTATGCCCGTGGTGACCGTGACCGTGACCGTGATCGTGGGAGGTACCGTGGGGGCTCGGGTCGAGATGACTATGGATATAGGAGGTCTCCTAGACGCTCACCCTACAGAGGTGGTCGTGATTATTCTCCTAGGGGCTCAACTTATGGTGGTGGAAGATCAAGAAGGGAGAGGTCTTATTCACCCTATGGCAGTCCAGAAAGGAAATACACTCGTGGCTCTAGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03040 map03040

Pfam Domains

Protein Families

RRM_1

Protein Analysis

146

Amino Acids

17.05

Weight (kDa)

11.12

Isoelectric Point (pI)

71.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001558)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G35785 AT4G35785 AT4G35785 AT4G35785 AT4G35785 AT4G35785
fragaria_vesca	FvH4_1g10991 FvH4_1g10991 FvH4_5g02820
malus_domestica	MD02G1123000.v1.1 MD06G1087700.v1.1 MD15G1237000.v1.1
prunus_persica	Prupe.5G103800_v2.0.a1 Prupe.5G103800_v2.0.a1 Prupe.7G175500_v2.0.a1 Prupe.7G175500_v2.0.a1 Prupe.7G175500_v2.0.a1 Prupe.7G175500_v2.0.a1
pyrus_communis	pycom02g09590 pycom06g08380 pycom15g21080
rosa_chinensis	RchiOBHm_Chr2g0098261 RchiOBHm_Chr4g0436561 RchiOBHm_Chr5g0052501 RchiOBHm_Chr6g0253581 RchiOBHm_Chr7g0197131
rosa_laevigata	RLG00000016780
rosa_multiflora	Rmu_sc0000441.1_g000019 Rmu_sc0002754.1_g000021 Rmu_sc0009183.1_g000006 Rmu_ssc0000465.1_g000024
rosa_roxburghii	Rroxscaffold_2G00144110 Rroxscaffold_3G00258670
rosa_rugosa	Rorug02G0071700 Rorug07G0037800 Rorug07G0037900 Rorug07G0038000
rosa_samantha	Rh2AG118700 Rh2AG118800 Rh2DG123400 Rh3DG184500 Rh3DG353300 Rh6DG075300 Rh7AG162600 Rh7BG164600
rosa_wichuraiana	Rw0G023370 Rw1G013400 Rw4G028610 Rw5G028060 Rw7G014190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	258
AccB1I	GGYRCC	1 cut(s)	258
AciI	CCGC	1 cut(s)	29
AcuI	CTGAAG	1 cut(s)	61
AfaI	GTAC	1 cut(s)	260
AfiI	CCNNNNNNNGG	2 cut(s)	182, 323
AgsI	TTSAA	3 cut(s)	24, 92, 202
AjnI	CCWGG	1 cut(s)	181
AluBI	AGCT	2 cut(s)	9, 18
AluI	AGCT	2 cut(s)	9, 18
Alw26I	GTCTC	1 cut(s)	306
Ama87I	CYCGRG	1 cut(s)	271
Asp718I	GGTACC	1 cut(s)	258
AspA2I	CCTAGG	1 cut(s)	344
AsuC2I	CCSGG	1 cut(s)	154
AsuHPI	GGTGA	3 cut(s)	239, 306, 387
AvaI	CYCGRG	1 cut(s)	271
AvrII	CCTAGG	1 cut(s)	344
BanI	GGYRCC	1 cut(s)	258
BanII	GRGCYC	2 cut(s)	272, 353
BauI	CACGAG	1 cut(s)	426
BciT130I	CCWGG	1 cut(s)	183
BclI	TGATCA	1 cut(s)	34
BcnI	CCSGG	1 cut(s)	154
BcoDI	GTCTC	1 cut(s)	306
BfaI	CTAG	4 cut(s)	210, 306, 345, 435
BfmI	CTRYAG	1 cut(s)	319
BlnI	CCTAGG	1 cut(s)	344
Bme1390I	CCNGG	2 cut(s)	154, 183
BmeT110I	CYCGRG	1 cut(s)	271
BmiI	GGNNCC	1 cut(s)	260
BmrFI	CCNGG	2 cut(s)	154, 183
BpuMI	CCSGG	1 cut(s)	154
BsaI	GGTCTC	1 cut(s)	306
BsaJI	CCNNGG	5 cut(s)	167, 182, 223, 262, 344
BsaXI	ACNNNNNCTCC	2 cut(s)	247, 277
Bsc4I	CCNNNNNNNGG	2 cut(s)	182, 323
BseBI	CCWGG	1 cut(s)	183
BseDI	CCNNGG	5 cut(s)	167, 182, 223, 262, 344
BseLI	CCNNNNNNNGG	2 cut(s)	182, 323
BshNI	GGYRCC	1 cut(s)	258
BsiHKCI	CYCGRG	1 cut(s)	271
BsiSI	CCGG	1 cut(s)	154
BslFI	GGGAC	2 cut(s)	136, 227
BslI	CCNNNNNNNGG	2 cut(s)	182, 323
BsmAI	GTCTC	1 cut(s)	306
BsmFI	GGGAC	2 cut(s)	136, 227
BsmI	GAATGC	1 cut(s)	81
Bso31I	GGTCTC	1 cut(s)	306
BsoBI	CYCGRG	1 cut(s)	271
Bsp1286I	GDGCHC	2 cut(s)	272, 353
Bsp143I	GATC	3 cut(s)	34, 247, 371
BspACI	CCGC	1 cut(s)	29
BspLI	GGNNCC	1 cut(s)	260
BspT107I	GGYRCC	1 cut(s)	258
BspTNI	GGTCTC	1 cut(s)	306
BssECI	CCNNGG	5 cut(s)	167, 182, 223, 262, 344
BssMI	GATC	3 cut(s)	34, 247, 371
BssSI	CACGAG	1 cut(s)	426
BssT1I	CCWWGG	2 cut(s)	167, 344
Bst2BI	CACGAG	1 cut(s)	426
Bst2UI	CCWGG	1 cut(s)	183
Bst4CI	ACNGT	4 cut(s)	233, 239, 245, 263
BstDSI	CCRYGG	2 cut(s)	223, 262
BstEII	GGTNACC	1 cut(s)	227
BstKTI	GATC	3 cut(s)	37, 250, 374
BstMAI	GTCTC	1 cut(s)	306
BstMBI	GATC	3 cut(s)	34, 247, 371
BstMWI	GCNNNNNNNGC	1 cut(s)	15
BstNI	CCWGG	1 cut(s)	183
BstPI	GGTNACC	1 cut(s)	227
BstSCI	CCNGG	2 cut(s)	152, 181
BstSFI	CTRYAG	1 cut(s)	319
BtgI	CCRYGG	2 cut(s)	223, 262
CseI	GACGC	1 cut(s)	318
Csp6I	GTAC	1 cut(s)	259
CviJI	RGCY	6 cut(s)	9, 18, 143, 270, 351, 432
CviKI_1	RGCY	6 cut(s)	9, 18, 143, 270, 351, 432
CviQI	GTAC	1 cut(s)	259
DpnI	GATC	3 cut(s)	36, 249, 373
DpnII	GATC	3 cut(s)	34, 247, 371
EciI	GGCGGA	1 cut(s)	18
Eco130I	CCWWGG	2 cut(s)	167, 344
Eco24I	GRGCYC	2 cut(s)	272, 353
Eco31I	GGTCTC	1 cut(s)	306
Eco57I	CTGAAG	1 cut(s)	61
Eco88I	CYCGRG	1 cut(s)	271
Eco91I	GGTNACC	1 cut(s)	227
EcoO65I	GGTNACC	1 cut(s)	227
EcoRII	CCWGG	1 cut(s)	181
EcoT14I	CCWWGG	2 cut(s)	167, 344
EcoT38I	GRGCYC	2 cut(s)	272, 353
ErhI	CCWWGG	2 cut(s)	167, 344
FaiI	YATR	9 cut(s)	47, 56, 70, 149, 219, 288, 294, 360, 402
FaqI	GGGAC	2 cut(s)	136, 227
FbaI	TGATCA	1 cut(s)	34
FriOI	GRGCYC	2 cut(s)	272, 353
FspBI	CTAG	4 cut(s)	210, 306, 345, 435
HapII	CCGG	1 cut(s)	154
HgaI	GACGC	1 cut(s)	318
HindIII	AAGCTT	1 cut(s)	7
HinfI	GANTC	1 cut(s)	172
HpaII	CCGG	1 cut(s)	154
HphI	GGTGA	3 cut(s)	239, 306, 387
Hpy188I	TCNGA	2 cut(s)	177, 197
Hpy188III	TCNNGA	5 cut(s)	278, 332, 375, 410, 435
HpyAV	CCTTC	1 cut(s)	372
HpyCH4III	ACNGT	4 cut(s)	233, 239, 245, 263
HpyF10VI	GCNNNNNNNGC	1 cut(s)	15
KpnI	GGTACC	1 cut(s)	262
Ksp22I	TGATCA	1 cut(s)	34
Kzo9I	GATC	3 cut(s)	34, 247, 371
LpnPI	CCDG	5 cut(s)	45, 167, 168, 195, 423
MaeI	CTAG	4 cut(s)	210, 306, 345, 435
MaeIII	GTNAC	3 cut(s)	227, 233, 239
MalI	GATC	3 cut(s)	36, 249, 373
MboI	GATC	3 cut(s)	34, 247, 371
MboII	GAAGA	1 cut(s)	381
MhlI	GDGCHC	2 cut(s)	272, 353
MlyI	GAGTC	1 cut(s)	166
MmeI	TCCRAC	2 cut(s)	85, 200
MnlI	CCTC	5 cut(s)	150, 249, 291, 317, 378
MseI	TTAA	1 cut(s)	11
MspI	CCGG	1 cut(s)	154
MspR9I	CCNGG	2 cut(s)	154, 183
Mva1269I	GAATGC	1 cut(s)	81
MvaI	CCWGG	1 cut(s)	183
MwoI	GCNNNNNNNGC	1 cut(s)	15
NciI	CCSGG	1 cut(s)	154
NdeII	GATC	3 cut(s)	34, 247, 371
NlaIV	GGNNCC	1 cut(s)	260
NmuCI	GTSAC	3 cut(s)	227, 233, 239
PctI	GAATGC	1 cut(s)	81
PfoI	TCCNGGA	1 cut(s)	152
PleI	GAGTC	1 cut(s)	166
PpsI	GAGTC	1 cut(s)	166
Psp6I	CCWGG	1 cut(s)	181
PspEI	GGTNACC	1 cut(s)	227
PspGI	CCWGG	1 cut(s)	181
PspN4I	GGNNCC	1 cut(s)	260
RsaI	GTAC	1 cut(s)	260
RsaNI	GTAC	1 cut(s)	259
SaqAI	TTAA	1 cut(s)	11
Sau3AI	GATC	3 cut(s)	34, 247, 371
SchI	GAGTC	1 cut(s)	166
ScrFI	CCNGG	2 cut(s)	154, 183
SduI	GDGCHC	2 cut(s)	272, 353
SetI	ASST	7 cut(s)	11, 20, 184, 260, 302, 328, 389
SfcI	CTRYAG	1 cut(s)	319
SsiI	CCGC	1 cut(s)	29
SspMI	CTAG	4 cut(s)	210, 306, 345, 435
StyD4I	CCNGG	2 cut(s)	152, 181
StyI	CCWWGG	2 cut(s)	167, 344
TaaI	ACNGT	4 cut(s)	233, 239, 245, 263
TaqI	TCGA	1 cut(s)	277
Tru1I	TTAA	1 cut(s)	11
Tru9I	TTAA	1 cut(s)	11
TseFI	GTSAC	3 cut(s)	227, 233, 239
Tsp45I	GTSAC	3 cut(s)	227, 233, 239
TspDTI	ATGAA	1 cut(s)	87
TspGWI	ACGGA	1 cut(s)	129
XbaI	TCTAGA	1 cut(s)	434
XmaJI	CCTAGG	1 cut(s)	344
XspI	CTAG	4 cut(s)	210, 306, 345, 435

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.