Rroxscaffold_1G00016900

Mediator-associated protein 1-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
21004402 .. 21019795
15394 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00016900.1

Sequence Viewer

Length: 180 bp
ATGACCTTTCCAGGGGTGGACCCTTATGTAGATATGAATGGATTGCATGCCTTCATCAAGAAATCACTAAATGTGAATGTTATTAAGAAACAATTGCAAGATAAGATTCAAAAGATGAGGAGGAAGTTTGAGAAGAATATGAAGAATGAGAAGTACAATCGACTAAGGCTCATAACTTGA

Protein Analysis

59

Amino Acids

7.11

Weight (kDa)

10.29

Isoelectric Point (pI)

31.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GeBP-like_DBD PF04504 5 - 50 6.6e-11 Glabrous-enhancer-binding protein-like family, DBD domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 155
AfiI CCNNNNNNNGG 1 cut(s) 12
AgsI TTSAA 1 cut(s) 110
AjnI CCWGG 1 cut(s) 10
AspS9I GGNCC 1 cut(s) 19
AvaII GGWCC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 12
Bme18I GGWCC 1 cut(s) 19
BmgT120I GGNCC 1 cut(s) 19
BmiI GGNNCC 1 cut(s) 21
BmrFI CCNGG 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 12
BseBI CCWGG 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 12
BseRI GAGGAG 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 12
BspLI GGNNCC 1 cut(s) 21
BssECI CCNNGG 1 cut(s) 11
Bst2UI CCWGG 1 cut(s) 12
BstC8I GCNNGC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 164
BstNI CCWGG 1 cut(s) 12
BstNSI RCATGY 1 cut(s) 50
BstSCI CCNGG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 48
Cfr13I GGNCC 1 cut(s) 19
Csp6I GTAC 1 cut(s) 154
CviAII CATG 1 cut(s) 47
CviJI RGCY 1 cut(s) 169
CviKI_1 RGCY 1 cut(s) 169
CviQI GTAC 1 cut(s) 154
DdeI CTNAG 1 cut(s) 164
Eco47I GGWCC 1 cut(s) 19
EcoRII CCWGG 1 cut(s) 10
FaeI CATG 1 cut(s) 50
FaiI YATR 5 cut(s) 27, 35, 48, 140, 173
FatI CATG 1 cut(s) 46
Hin1II CATG 1 cut(s) 50
HinfI GANTC 1 cut(s) 106
Hpy166II GTNNAC 1 cut(s) 19
Hpy188III TCNNGA 1 cut(s) 58
Hpy8I GTNNAC 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 61
HpyCH4V TGCA 2 cut(s) 46, 97
HpyF3I CTNAG 1 cut(s) 164
Hsp92II CATG 1 cut(s) 50
LpnPI CCDG 1 cut(s) 24
MboII GAAGA 2 cut(s) 145, 154
MfeI CAATTG 1 cut(s) 92
MluCI AATT 1 cut(s) 92
MnlI CCTC 2 cut(s) 111, 114
MseI TTAA 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 12
MunI CAATTG 1 cut(s) 92
MvaI CCWGG 1 cut(s) 12
NlaIII CATG 1 cut(s) 50
NlaIV GGNNCC 1 cut(s) 21
NspI RCATGY 1 cut(s) 50
PaeI GCATGC 1 cut(s) 50
PfeI GAWTC 1 cut(s) 106
Psp6I CCWGG 1 cut(s) 10
PspGI CCWGG 1 cut(s) 10
PspN4I GGNNCC 1 cut(s) 21
PspPI GGNCC 1 cut(s) 19
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
SaqAI TTAA 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 19
ScrFI CCNGG 1 cut(s) 12
SetI ASST 1 cut(s) 8
SgeI CNNG 5 cut(s) 23, 24, 59, 70, 110
SinI GGWCC 1 cut(s) 19
SphI GCATGC 1 cut(s) 50
Sse9I AATT 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 10
TaqI TCGA 1 cut(s) 160
TasI AATT 1 cut(s) 92
TatI WGTACW 1 cut(s) 153
TfiI GAWTC 1 cut(s) 106
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TspDTI ATGAA 3 cut(s) 43, 50, 155
VpaK11BI GGWCC 1 cut(s) 19
XceI RCATGY 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.