Rroxscaffold_3G00229220
BHLH Family

Transcription factor ABORTED

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
13697806 .. 13700709
2904 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00229220.1

Sequence Viewer

Length: 249 bp
ATGCCCTTAGACTCTGGGATTTATGCAAAAACATTTATGTCAAACCAGCCCTGTTGGTTGAACTGTTCCTCTAGTAACAGAGATTCAAGTGCTATGCTGGAAAGAGATGGGACCCGAGTTTTGGTTCCAACTGCAGGAGGCCGGGGGTTTATGATTGAGCTGTTTGTCTCCAAAGATTCTCCGAGGACCAGCATGTCATTGATTTCATCACAGCACAATGCAACATTTGGTGCAAGCAAGACACCCTGA

Protein Analysis

82

Amino Acids

8.88

Weight (kDa)

8.8

Isoelectric Point (pI)

67.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 193
AfiI CCNNNNNNNGG 2 cut(s) 121, 134
AgsI TTSAA 2 cut(s) 61, 87
AluBI AGCT 1 cut(s) 160
AluI AGCT 1 cut(s) 160
Alw26I GTCTC 1 cut(s) 172
Ama87I CYCGRG 1 cut(s) 114
AoxI GGCC 1 cut(s) 139
ArsI GACNNNNNNTTYG 2 cut(s) 103, 135
AspS9I GGNCC 2 cut(s) 111, 186
AsuC2I CCSGG 1 cut(s) 143
AvaI CYCGRG 1 cut(s) 114
AvaII GGWCC 2 cut(s) 111, 186
BccI CCATC 1 cut(s) 101
BcnI CCSGG 1 cut(s) 143
BcoDI GTCTC 1 cut(s) 172
BfaI CTAG 1 cut(s) 72
BfmI CTRYAG 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 143
Bme18I GGWCC 2 cut(s) 111, 186
BmeT110I CYCGRG 1 cut(s) 114
BmgT120I GGNCC 2 cut(s) 111, 186
BmiI GGNNCC 3 cut(s) 112, 113, 126
BmrFI CCNGG 1 cut(s) 143
BpuMI CCSGG 1 cut(s) 143
BsaJI CCNNGG 2 cut(s) 142, 182
Bsc4I CCNNNNNNNGG 2 cut(s) 121, 134
BseDI CCNNGG 2 cut(s) 142, 182
BseLI CCNNNNNNNGG 2 cut(s) 121, 134
BshFI GGCC 1 cut(s) 141
BsiHKCI CYCGRG 1 cut(s) 114
BsiSI CCGG 1 cut(s) 142
BslFI GGGAC 1 cut(s) 124
BslI CCNNNNNNNGG 2 cut(s) 121, 134
BsmAI GTCTC 1 cut(s) 172
BsmFI GGGAC 1 cut(s) 124
BsnI GGCC 1 cut(s) 141
BsoBI CYCGRG 1 cut(s) 114
BspANI GGCC 1 cut(s) 141
BspLI GGNNCC 3 cut(s) 112, 113, 126
BspMAI CTGCAG 1 cut(s) 136
BssECI CCNNGG 2 cut(s) 142, 182
Bst4CI ACNGT 1 cut(s) 65
BstC8I GCNNGC 1 cut(s) 235
BstDEI CTNAG 1 cut(s) 7
BstMAI GTCTC 1 cut(s) 172
BstNSI RCATGY 1 cut(s) 196
BstSCI CCNGG 1 cut(s) 141
BstSFI CTRYAG 1 cut(s) 132
BsuRI GGCC 1 cut(s) 141
Cac8I GCNNGC 1 cut(s) 235
Cfr13I GGNCC 2 cut(s) 111, 186
CviAII CATG 1 cut(s) 193
CviJI RGCY 3 cut(s) 49, 141, 160
CviKI_1 RGCY 3 cut(s) 49, 141, 160
DdeI CTNAG 1 cut(s) 7
DrdI GACNNNNNNGTC 1 cut(s) 193
DseDI GACNNNNNNGTC 1 cut(s) 193
Eco47I GGWCC 2 cut(s) 111, 186
Eco88I CYCGRG 1 cut(s) 114
EcoO109I RGGNCCY 1 cut(s) 111
FaeI CATG 1 cut(s) 196
FaiI YATR 5 cut(s) 24, 38, 95, 152, 194
FaqI GGGAC 1 cut(s) 124
FatI CATG 1 cut(s) 192
FspBI CTAG 1 cut(s) 72
HaeIII GGCC 1 cut(s) 141
HapII CCGG 1 cut(s) 142
Hin1II CATG 1 cut(s) 196
HinfI GANTC 3 cut(s) 11, 83, 176
HpaII CCGG 1 cut(s) 142
Hpy188I TCNGA 1 cut(s) 183
HpyCH4III ACNGT 1 cut(s) 65
HpyCH4V TGCA 4 cut(s) 26, 134, 221, 233
HpyF3I CTNAG 1 cut(s) 7
Hsp92II CATG 1 cut(s) 196
KflI GGGWCCC 1 cut(s) 111
LpnPI CCDG 6 cut(s) 59, 64, 83, 120, 155, 202
MaeI CTAG 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 74
MlyI GAGTC 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 152
MnlI CCTC 3 cut(s) 79, 131, 177
MspI CCGG 1 cut(s) 142
MspR9I CCNGG 1 cut(s) 143
NciI CCSGG 1 cut(s) 143
NlaIII CATG 1 cut(s) 196
NlaIV GGNNCC 3 cut(s) 112, 113, 126
NspI RCATGY 1 cut(s) 196
PfeI GAWTC 2 cut(s) 83, 176
PleI GAGTC 1 cut(s) 5
PpsI GAGTC 1 cut(s) 5
PpuMI RGGWCCY 1 cut(s) 111
Psp5II RGGWCCY 1 cut(s) 111
PspN4I GGNNCC 3 cut(s) 112, 113, 126
PspPI GGNCC 2 cut(s) 111, 186
PspPPI RGGWCCY 1 cut(s) 111
PstI CTGCAG 1 cut(s) 136
Sau96I GGNCC 2 cut(s) 111, 186
SchI GAGTC 1 cut(s) 5
ScrFI CCNGG 1 cut(s) 143
SetI ASST 1 cut(s) 162
SfcI CTRYAG 1 cut(s) 132
SinI GGWCC 2 cut(s) 111, 186
SspMI CTAG 1 cut(s) 72
StyD4I CCNGG 1 cut(s) 141
TaaI ACNGT 1 cut(s) 65
TfiI GAWTC 2 cut(s) 83, 176
TspDTI ATGAA 1 cut(s) 195
VpaK11BI GGWCC 2 cut(s) 111, 186
XceI RCATGY 1 cut(s) 196
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.