Rh3AG263900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0001641
Physical Location & Seq
Reverse (-)
29360823 .. 29367857
7035 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG263900.1

Sequence Viewer

Length: 204 bp
ATGGGGAGGAAGGGGGTGAATTTGGGTGGTAGATTATATCCTCAGGCTGTTGAGAAGGCTTCACAAACTGATAAGCTGTTTGTGCTTCTCCAAACAACATTCATAATTTTCCAAATTATAGAGTCCATGCCACCATTGAAGATCCAAACAGTGAAGCCACAGTCAAGCTTAGAGGAAAACCAGCTGAACAATTGTTTGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.55

Weight (kDa)

7.89

Isoelectric Point (pI)

55.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 136
AcsI RAATTY 1 cut(s) 19
AgsI TTSAA 1 cut(s) 139
AjuI GAANNNNNNNTTGG 1 cut(s) 179
AluBI AGCT 3 cut(s) 76, 168, 184
AluI AGCT 3 cut(s) 76, 168, 184
AlwI GGATC 1 cut(s) 136
ApoI RAATTY 1 cut(s) 19
AsuHPI GGTGA 1 cut(s) 28
AxyI CCTNAGG 1 cut(s) 42
Bse21I CCTNAGG 1 cut(s) 42
BseMII CTCAG 1 cut(s) 56
Bsp143I GATC 1 cut(s) 141
BspCNI CTCAG 1 cut(s) 55
BspPI GGATC 1 cut(s) 136
BssMI GATC 1 cut(s) 141
Bst4CI ACNGT 2 cut(s) 151, 162
BstDEI CTNAG 2 cut(s) 42, 169
BstKTI GATC 1 cut(s) 144
BstMBI GATC 1 cut(s) 141
BstMWI GCNNNNNNNGC 1 cut(s) 82
BstX2I RGATCY 1 cut(s) 141
BstYI RGATCY 1 cut(s) 141
Bsu36I CCTNAGG 1 cut(s) 42
BtsIMutI CAGTG 1 cut(s) 156
CviAII CATG 1 cut(s) 127
CviJI RGCY 6 cut(s) 47, 59, 76, 157, 168, 184
CviKI_1 RGCY 6 cut(s) 47, 59, 76, 157, 168, 184
DdeI CTNAG 2 cut(s) 42, 169
DpnI GATC 1 cut(s) 143
DpnII GATC 1 cut(s) 141
Eco81I CCTNAGG 1 cut(s) 42
FaeI CATG 1 cut(s) 130
FaiI YATR 4 cut(s) 37, 104, 119, 128
FatI CATG 1 cut(s) 126
Hin1II CATG 1 cut(s) 130
HindIII AAGCTT 1 cut(s) 166
HinfI GANTC 1 cut(s) 122
HphI GGTGA 1 cut(s) 28
HpyAV CCTTC 2 cut(s) 4, 49
HpyCH4III ACNGT 2 cut(s) 151, 162
HpyF10VI GCNNNNNNNGC 1 cut(s) 82
HpyF3I CTNAG 2 cut(s) 42, 169
Hsp92II CATG 1 cut(s) 130
Kzo9I GATC 1 cut(s) 141
LpnPI CCDG 2 cut(s) 29, 194
MalI GATC 1 cut(s) 143
MboI GATC 1 cut(s) 141
MboII GAAGA 1 cut(s) 151
MfeI CAATTG 1 cut(s) 190
MflI RGATCY 1 cut(s) 141
MluCI AATT 4 cut(s) 19, 105, 114, 190
MlyI GAGTC 1 cut(s) 131
MnlI CCTC 2 cut(s) 51, 166
MspA1I CMGCKG 1 cut(s) 184
MunI CAATTG 1 cut(s) 190
MwoI GCNNNNNNNGC 1 cut(s) 82
NdeII GATC 1 cut(s) 141
NlaIII CATG 1 cut(s) 130
PleI GAGTC 1 cut(s) 130
PpsI GAGTC 1 cut(s) 130
PsuI RGATCY 1 cut(s) 141
PvuII CAGCTG 1 cut(s) 184
Sau3AI GATC 1 cut(s) 141
SchI GAGTC 1 cut(s) 131
SetI ASST 3 cut(s) 78, 170, 186
SgeI CNNG 4 cut(s) 56, 139, 177, 193
Sse9I AATT 4 cut(s) 19, 105, 114, 190
TaaI ACNGT 2 cut(s) 151, 162
TasI AATT 4 cut(s) 19, 105, 114, 190
TscAI CASTG 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 91
TspRI CASTG 1 cut(s) 156
XapI RAATTY 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.