Rh7AG412300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0001641
Physical Location & Seq
Reverse (-)
55254571 .. 55270636
16066 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG412300.1

Sequence Viewer

Length: 168 bp
ATGAAAGAAGCAGGTAAATCAAGAATGCTCGAGAAGACATTTTGGACGGGCTGCAACAGTTCTATAGAGAAACTTCTGCAGTTGAAGTCCATGCCACCATTGAAGATCCAAACTGTGAAGCCACAGTCAAGCTTAGAGGAAAACCAGCTGAACAATTGTTTGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.28

Weight (kDa)

8.71

Isoelectric Point (pI)

53.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 2
AclWI GGATC 1 cut(s) 100
AgsI TTSAA 2 cut(s) 85, 103
AjuI GAANNNNNNNTTGG 1 cut(s) 143
AluBI AGCT 2 cut(s) 132, 148
AluI AGCT 2 cut(s) 132, 148
AlwI GGATC 1 cut(s) 100
Ama87I CYCGRG 1 cut(s) 29
ApeKI GCWGC 1 cut(s) 51
AvaI CYCGRG 1 cut(s) 29
BbsI GAAGAC 1 cut(s) 41
BbvI GCAGC 1 cut(s) 38
BfmI CTRYAG 2 cut(s) 63, 77
BfuAI ACCTGC 1 cut(s) 2
BisI GCNGC 1 cut(s) 52
BlsI GCNGC 1 cut(s) 53
BmeT110I CYCGRG 1 cut(s) 29
BpiI GAAGAC 1 cut(s) 41
BseXI GCAGC 1 cut(s) 38
BsiHKCI CYCGRG 1 cut(s) 29
BsmI GAATGC 1 cut(s) 30
BsoBI CYCGRG 1 cut(s) 29
Bsp143I GATC 1 cut(s) 105
BspMAI CTGCAG 1 cut(s) 81
BspMI ACCTGC 1 cut(s) 2
BspPI GGATC 1 cut(s) 100
BssMI GATC 1 cut(s) 105
Bst4CI ACNGT 3 cut(s) 59, 115, 126
BstDEI CTNAG 1 cut(s) 133
BstKTI GATC 1 cut(s) 108
BstMBI GATC 1 cut(s) 105
BstSFI CTRYAG 2 cut(s) 63, 77
BstV1I GCAGC 1 cut(s) 38
BstV2I GAAGAC 1 cut(s) 41
BstX2I RGATCY 1 cut(s) 105
BstYI RGATCY 1 cut(s) 105
BveI ACCTGC 1 cut(s) 2
CviAII CATG 1 cut(s) 91
CviJI RGCY 4 cut(s) 51, 121, 132, 148
CviKI_1 RGCY 4 cut(s) 51, 121, 132, 148
DdeI CTNAG 1 cut(s) 133
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
Eco88I CYCGRG 1 cut(s) 29
FaeI CATG 1 cut(s) 94
FaiI YATR 2 cut(s) 65, 92
FatI CATG 1 cut(s) 90
Fnu4HI GCNGC 1 cut(s) 52
Fsp4HI GCNGC 1 cut(s) 52
GluI GCNGC 1 cut(s) 52
Hin1II CATG 1 cut(s) 94
HindIII AAGCTT 1 cut(s) 130
Hpy188III TCNNGA 2 cut(s) 21, 31
HpyCH4III ACNGT 3 cut(s) 59, 115, 126
HpyCH4V TGCA 2 cut(s) 54, 79
HpyF3I CTNAG 1 cut(s) 133
Hsp92II CATG 1 cut(s) 94
Kzo9I GATC 1 cut(s) 105
LpnPI CCDG 1 cut(s) 158
Lsp1109I GCAGC 1 cut(s) 38
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MboII GAAGA 2 cut(s) 46, 115
MfeI CAATTG 1 cut(s) 154
MflI RGATCY 1 cut(s) 105
MluCI AATT 1 cut(s) 154
MnlI CCTC 1 cut(s) 130
MspA1I CMGCKG 1 cut(s) 148
MunI CAATTG 1 cut(s) 154
Mva1269I GAATGC 1 cut(s) 30
NdeII GATC 1 cut(s) 105
NlaIII CATG 1 cut(s) 94
PaeR7I CTCGAG 1 cut(s) 29
PctI GAATGC 1 cut(s) 30
PkrI GCNGC 1 cut(s) 53
PstI CTGCAG 1 cut(s) 81
PsuI RGATCY 1 cut(s) 105
PvuII CAGCTG 1 cut(s) 148
SatI GCNGC 1 cut(s) 52
Sau3AI GATC 1 cut(s) 105
SetI ASST 3 cut(s) 16, 134, 150
SfcI CTRYAG 2 cut(s) 63, 77
Sfr274I CTCGAG 1 cut(s) 29
SgeI CNNG 8 cut(s) 24, 33, 41, 43, 60, 103, 141, 157
SlaI CTCGAG 1 cut(s) 29
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 1 cut(s) 154
TaaI ACNGT 3 cut(s) 59, 115, 126
TaqI TCGA 1 cut(s) 30
TasI AATT 1 cut(s) 154
TseI GCWGC 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 17
XhoI CTCGAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.