Rroxscaffold_4G00299200

Ferric reduction oxidase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
19136960 .. 19137190
231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00299200.1

Sequence Viewer

Length: 231 bp
ATGTTCATAAATGTGCCTAGTATTTCCAAGCTGCAATGGCATCCTTTCACTGTTACTTCAAACAGTAATTTGGAGCCAGAGAAGATCAGTGTCGTCATCAAAGGTGAAGGAAGTTGGACCAGGAAGCTTTACCAAGTCCTTTCATCGCCTTCTACAAGTGATCGGATTGAGGCTGCAGTTGAAGGGCCTTATGGACCTGATGCAACTCATTTTCTAAGGTTTGAAAGATAA

Protein Analysis

76

Amino Acids

8.58

Weight (kDa)

6.72

Isoelectric Point (pI)

33.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FAD_binding_8 PF08022 1 - 67 2.7e-18 FAD-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 60, 182, 224
AjnI CCWGG 1 cut(s) 119
AluBI AGCT 2 cut(s) 31, 127
AluI AGCT 2 cut(s) 31, 127
AoxI GGCC 1 cut(s) 185
ApeKI GCWGC 2 cut(s) 31, 173
AspS9I GGNCC 3 cut(s) 117, 185, 194
AsuHPI GGTGA 1 cut(s) 116
AvaII GGWCC 2 cut(s) 117, 194
BbvI GCAGC 2 cut(s) 18, 160
BciT130I CCWGG 1 cut(s) 121
BfaI CTAG 1 cut(s) 18
BfmI CTRYAG 1 cut(s) 174
BisI GCNGC 2 cut(s) 32, 174
BlsI GCNGC 2 cut(s) 33, 175
Bme1390I CCNGG 1 cut(s) 121
Bme18I GGWCC 2 cut(s) 117, 194
BmgT120I GGNCC 3 cut(s) 117, 185, 194
BmiI GGNNCC 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 121
BmsI GCATC 2 cut(s) 49, 190
Bse3DI GCAATG 1 cut(s) 41
BseBI CCWGG 1 cut(s) 121
BseGI GGATG 1 cut(s) 40
BseMI GCAATG 1 cut(s) 41
BseXI GCAGC 2 cut(s) 18, 160
BshFI GGCC 1 cut(s) 187
BsnI GGCC 1 cut(s) 187
Bsp143I GATC 2 cut(s) 84, 160
BspANI GGCC 1 cut(s) 187
BspLI GGNNCC 1 cut(s) 75
BspMAI CTGCAG 1 cut(s) 178
BsrDI GCAATG 1 cut(s) 41
BssMI GATC 2 cut(s) 84, 160
Bst2UI CCWGG 1 cut(s) 121
Bst4CI ACNGT 2 cut(s) 52, 65
BstDEI CTNAG 1 cut(s) 215
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 2 cut(s) 87, 163
BstMBI GATC 2 cut(s) 84, 160
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstNI CCWGG 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 119
BstSFI CTRYAG 1 cut(s) 174
BstV1I GCAGC 2 cut(s) 18, 160
BsuRI GGCC 1 cut(s) 187
BtgZI GCGATG 1 cut(s) 129
BtsCI GGATG 1 cut(s) 40
BtsIMutI CAGTG 2 cut(s) 48, 94
Cfr13I GGNCC 3 cut(s) 117, 185, 194
CviJI RGCY 5 cut(s) 31, 76, 127, 173, 187
CviKI_1 RGCY 5 cut(s) 31, 76, 127, 173, 187
DdeI CTNAG 1 cut(s) 215
DpnI GATC 2 cut(s) 86, 162
DpnII GATC 2 cut(s) 84, 160
Eco47I GGWCC 2 cut(s) 117, 194
EcoO109I RGGNCCY 1 cut(s) 185
EcoRII CCWGG 1 cut(s) 119
FaiI YATR 2 cut(s) 8, 192
Fnu4HI GCNGC 2 cut(s) 32, 174
FokI GGATG 1 cut(s) 27
Fsp4HI GCNGC 2 cut(s) 32, 174
FspBI CTAG 1 cut(s) 18
GluI GCNGC 2 cut(s) 32, 174
HaeIII GGCC 1 cut(s) 187
HindIII AAGCTT 1 cut(s) 125
HphI GGTGA 1 cut(s) 116
Hpy188I TCNGA 1 cut(s) 165
HpyAV CCTTC 3 cut(s) 101, 159, 176
HpyCH4III ACNGT 2 cut(s) 52, 65
HpyCH4V TGCA 3 cut(s) 34, 176, 203
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
HpyF3I CTNAG 1 cut(s) 215
Kzo9I GATC 2 cut(s) 84, 160
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 4 cut(s) 90, 106, 133, 210
Lsp1109I GCAGC 2 cut(s) 18, 160
LweI GCATC 2 cut(s) 49, 190
MaeI CTAG 1 cut(s) 18
MaeIII GTNAC 1 cut(s) 52
MalI GATC 2 cut(s) 86, 162
MboI GATC 2 cut(s) 84, 160
MboII GAAGA 1 cut(s) 94
MluCI AATT 1 cut(s) 67
MmeI TCCRAC 1 cut(s) 95
MnlI CCTC 1 cut(s) 163
MslI CAYNNNNRTG 1 cut(s) 11
MspR9I CCNGG 1 cut(s) 121
MvaI CCWGG 1 cut(s) 121
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeII GATC 2 cut(s) 84, 160
NlaIV GGNNCC 1 cut(s) 75
PkrI GCNGC 2 cut(s) 33, 175
Psp6I CCWGG 1 cut(s) 119
PspGI CCWGG 1 cut(s) 119
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 3 cut(s) 117, 185, 194
PstI CTGCAG 1 cut(s) 178
RseI CAYNNNNRTG 1 cut(s) 11
SatI GCNGC 2 cut(s) 32, 174
Sau3AI GATC 2 cut(s) 84, 160
Sau96I GGNCC 3 cut(s) 117, 185, 194
ScrFI CCNGG 1 cut(s) 121
SetI ASST 5 cut(s) 33, 106, 129, 199, 221
SfaNI GCATC 2 cut(s) 49, 190
SfcI CTRYAG 1 cut(s) 174
SgeI CNNG 8 cut(s) 30, 40, 89, 132, 133, 146, 168, 209
SinI GGWCC 2 cut(s) 117, 194
SmiMI CAYNNNNRTG 1 cut(s) 11
Sse9I AATT 1 cut(s) 67
SspMI CTAG 1 cut(s) 18
StyD4I CCNGG 1 cut(s) 119
TaaI ACNGT 2 cut(s) 52, 65
TasI AATT 1 cut(s) 67
TscAI CASTG 2 cut(s) 55, 94
TseI GCWGC 2 cut(s) 31, 173
TspDTI ATGAA 1 cut(s) 132
TspRI CASTG 2 cut(s) 55, 94
VpaK11BI GGWCC 2 cut(s) 117, 194
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.