Rorug04G0218600

UPF0481 protein At3g47200-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
37749452 .. 37749802
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0218600.1

Sequence Viewer

Length: 351 bp
ATGGCATCTCCAAAACAGGTAGAACTGAGAGCAATTAAGGAAGGCATTCATTTACTTGAATCAATACATGCTACAAATGTCATCATTGAGACTGATTGTCTGCAAGCAACTTGGGATGTGGCTACTGCTCAACATGAAACTCTAGTCGATGGTAATTTGATTGATGACATCAAAACAAGCTTACTTGCTTTACCTTCTGTGTCATTGGGCTACACTCCTAGAACAGCCAACTCGGTAGCTCACCGGCTTGCTAGAATTGCTTATGAAAGTAGCATTAGTCTATTTTGGTTTGATCATGTTCTAGAGTGCATCATAGATGCACTAAACTTCGATTGTAATCAACCCTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

12.82

Weight (kDa)

4.82

Isoelectric Point (pI)

33.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 85 3.5e-10 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 59
AhdI GACNNNNNGTC 1 cut(s) 96
AluBI AGCT 2 cut(s) 180, 239
AluI AGCT 2 cut(s) 180, 239
Alw26I GTCTC 1 cut(s) 83
Asp700I GAANNNNTTC 1 cut(s) 45
AsuHPI GGTGA 1 cut(s) 233
BccI CCATC 1 cut(s) 143
BclI TGATCA 1 cut(s) 292
BcoDI GTCTC 1 cut(s) 83
BfaI CTAG 4 cut(s) 143, 219, 252, 302
BmeRI GACNNNNNGTC 1 cut(s) 96
BmsI GCATC 3 cut(s) 14, 307, 318
BsaBI GATNNNNATC 1 cut(s) 336
Bse118I RCCGGY 1 cut(s) 243
Bse8I GATNNNNATC 1 cut(s) 336
BseGI GGATG 1 cut(s) 121
BseJI GATNNNNATC 1 cut(s) 336
BseMII CTCAG 1 cut(s) 17
BsiSI CCGG 1 cut(s) 244
BsmAI GTCTC 1 cut(s) 83
BsmI GAATGC 1 cut(s) 45
Bsp143I GATC 1 cut(s) 292
BspCNI CTCAG 1 cut(s) 18
BsrFI RCCGGY 1 cut(s) 243
BssAI RCCGGY 1 cut(s) 243
BssMI GATC 1 cut(s) 292
BstC8I GCNNGC 2 cut(s) 105, 249
BstDEI CTNAG 2 cut(s) 26, 348
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 1 cut(s) 295
BstMAI GTCTC 1 cut(s) 83
BstMBI GATC 1 cut(s) 292
BstMWI GCNNNNNNNGC 1 cut(s) 257
BstNSI RCATGY 1 cut(s) 71
BtsCI GGATG 1 cut(s) 121
Cac8I GCNNGC 2 cut(s) 105, 249
Cfr10I RCCGGY 1 cut(s) 243
CviAII CATG 3 cut(s) 68, 134, 296
CviJI RGCY 6 cut(s) 122, 180, 210, 227, 239, 247
CviKI_1 RGCY 6 cut(s) 122, 180, 210, 227, 239, 247
DdeI CTNAG 2 cut(s) 26, 348
DpnI GATC 1 cut(s) 294
DpnII GATC 1 cut(s) 292
DriI GACNNNNNGTC 1 cut(s) 96
Eam1105I GACNNNNNGTC 1 cut(s) 96
FaeI CATG 3 cut(s) 71, 137, 299
FaiI YATR 5 cut(s) 69, 135, 264, 297, 314
FatI CATG 3 cut(s) 67, 133, 295
FbaI TGATCA 1 cut(s) 292
FokI GGATG 1 cut(s) 128
FspBI CTAG 4 cut(s) 143, 219, 252, 302
HapII CCGG 1 cut(s) 244
Hin1II CATG 3 cut(s) 71, 137, 299
HindIII AAGCTT 1 cut(s) 178
HinfI GANTC 1 cut(s) 59
HpaII CCGG 1 cut(s) 244
HphI GGTGA 1 cut(s) 233
Hpy188III TCNNGA 1 cut(s) 302
HpyAV CCTTC 2 cut(s) 35, 204
HpyCH4V TGCA 3 cut(s) 103, 309, 320
HpyF10VI GCNNNNNNNGC 1 cut(s) 257
HpyF3I CTNAG 2 cut(s) 26, 348
Hsp92II CATG 3 cut(s) 71, 137, 299
Ksp22I TGATCA 1 cut(s) 292
Kzo9I GATC 1 cut(s) 292
LpnPI CCDG 2 cut(s) 2, 257
LweI GCATC 3 cut(s) 14, 307, 318
MaeI CTAG 4 cut(s) 143, 219, 252, 302
MalI GATC 1 cut(s) 294
MboI GATC 1 cut(s) 292
MluCI AATT 3 cut(s) 33, 154, 255
MroXI GAANNNNTTC 1 cut(s) 45
MseI TTAA 1 cut(s) 36
MspI CCGG 1 cut(s) 244
Mva1269I GAATGC 1 cut(s) 45
MwoI GCNNNNNNNGC 1 cut(s) 257
NdeII GATC 1 cut(s) 292
NlaIII CATG 3 cut(s) 71, 137, 299
NspI RCATGY 1 cut(s) 71
PctI GAATGC 1 cut(s) 45
PdmI GAANNNNTTC 1 cut(s) 45
PfeI GAWTC 1 cut(s) 59
SaqAI TTAA 1 cut(s) 36
Sau3AI GATC 1 cut(s) 292
SetI ASST 4 cut(s) 21, 182, 196, 241
SfaNI GCATC 3 cut(s) 14, 307, 318
Sse9I AATT 3 cut(s) 33, 154, 255
SspMI CTAG 4 cut(s) 143, 219, 252, 302
TaqI TCGA 2 cut(s) 147, 330
TasI AATT 3 cut(s) 33, 154, 255
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
TspDTI ATGAA 3 cut(s) 38, 150, 279
XbaI TCTAGA 1 cut(s) 301
XceI RCATGY 1 cut(s) 71
XmnI GAANNNNTTC 1 cut(s) 45
XspI CTAG 4 cut(s) 143, 219, 252, 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.