Rorug05G0218500

Cgr1 family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
22462318 .. 22462506
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0218500.1

Sequence Viewer

Length: 189 bp
ATGGCAGTGGCAAGGGGCTTACAGGTTCAAGTCTCACACATCTATAGGGAGGGTAATATTCCAGCTGATGTCCTTACTAACTTTGGTGCTTTCCATGTGGGCAGTCATGCTTGGTCCATCCTCCCCCAGTTCTTAACTTCTGCATTTGGACGTGACTTTAATGCGTGGCTGACATATAGGTTTATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.0

Weight (kDa)

8.4

Isoelectric Point (pI)

23.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 29
AjiI CACGTC 1 cut(s) 152
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 37
AspS9I GGNCC 1 cut(s) 114
AvaII GGWCC 1 cut(s) 114
BccI CCATC 1 cut(s) 125
BcoDI GTCTC 1 cut(s) 37
BfmI CTRYAG 1 cut(s) 43
Bme18I GGWCC 1 cut(s) 114
BmgBI CACGTC 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 114
BmrI ACTGGG 1 cut(s) 121
BmuI ACTGGG 1 cut(s) 121
Bse1I ACTGG 1 cut(s) 127
BseGI GGATG 1 cut(s) 117
BseNI ACTGG 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 127
BstF5I GGATG 1 cut(s) 117
BstMAI GTCTC 1 cut(s) 37
BstSFI CTRYAG 1 cut(s) 43
BtrI CACGTC 1 cut(s) 152
BtsCI GGATG 1 cut(s) 117
BtsI GCAGTG 1 cut(s) 12
BtsIMutI CAGTG 1 cut(s) 12
Cfr13I GGNCC 1 cut(s) 114
CviAII CATG 2 cut(s) 95, 107
CviJI RGCY 3 cut(s) 18, 65, 169
CviKI_1 RGCY 3 cut(s) 18, 65, 169
Eco47I GGWCC 1 cut(s) 114
FaeI CATG 2 cut(s) 98, 110
FaiI YATR 7 cut(s) 45, 96, 108, 175, 177, 185, 187
FatI CATG 2 cut(s) 94, 106
FokI GGATG 1 cut(s) 104
Hin1II CATG 2 cut(s) 98, 110
HpyCH4IV ACGT 1 cut(s) 151
HpyCH4V TGCA 1 cut(s) 143
HpySE526I ACGT 1 cut(s) 151
Hsp92II CATG 2 cut(s) 98, 110
LpnPI CCDG 3 cut(s) 8, 75, 140
MaeII ACGT 1 cut(s) 151
MaeIII GTNAC 1 cut(s) 152
MnlI CCTC 2 cut(s) 43, 131
MseI TTAA 2 cut(s) 134, 159
MspA1I CMGCKG 1 cut(s) 65
NlaIII CATG 2 cut(s) 98, 110
NmuCI GTSAC 1 cut(s) 152
PspPI GGNCC 1 cut(s) 114
PvuII CAGCTG 1 cut(s) 65
SaqAI TTAA 2 cut(s) 134, 159
Sau96I GGNCC 1 cut(s) 114
SetI ASST 4 cut(s) 27, 67, 154, 182
SfcI CTRYAG 1 cut(s) 43
SinI GGWCC 1 cut(s) 114
SspI AATATT 1 cut(s) 58
TaiI ACGT 1 cut(s) 154
Tru1I TTAA 2 cut(s) 134, 159
Tru9I TTAA 2 cut(s) 134, 159
TscAI CASTG 1 cut(s) 12
TseFI GTSAC 1 cut(s) 152
Tsp45I GTSAC 1 cut(s) 152
TspRI CASTG 1 cut(s) 12
VpaK11BI GGWCC 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.