Rorug06G0396100

aspartate--tRNA ligase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
54232069 .. 54232245
177 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0396100.1

Sequence Viewer

Length: 177 bp
ATGTTCCCAGGGAAGCCAACTACGTTGCTGATGCTGTTACAAATATGGGTCATAGATCATCTACTCCTATCACTTGGTCAAAAAAGTTGCCGTTCTCAGCTTTGTCTGCTTTTAATTTTGATCAATTTAGTTCTGGTTGTAATAGGGGCTTTAAGTTGTAATTTATTTTCCTCCTAA

Protein Analysis

58

Amino Acids

6.39

Weight (kDa)

8.66

Isoelectric Point (pI)

45.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 7
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
BceAI ACGGC 1 cut(s) 75
BciT130I CCWGG 1 cut(s) 9
BclI TGATCA 1 cut(s) 120
Bme1390I CCNGG 1 cut(s) 9
BmrFI CCNGG 1 cut(s) 9
BmsI GCATC 1 cut(s) 21
BsaJI CCNNGG 2 cut(s) 7, 8
BseBI CCWGG 1 cut(s) 9
BseDI CCNNGG 2 cut(s) 7, 8
BseMII CTCAG 1 cut(s) 110
Bsp143I GATC 2 cut(s) 55, 120
BspCNI CTCAG 1 cut(s) 109
BssECI CCNNGG 2 cut(s) 7, 8
BssMI GATC 2 cut(s) 55, 120
Bst2UI CCWGG 1 cut(s) 9
BstDEI CTNAG 1 cut(s) 96
BstKTI GATC 2 cut(s) 58, 123
BstMBI GATC 2 cut(s) 55, 120
BstMWI GCNNNNNNNGC 1 cut(s) 106
BstNI CCWGG 1 cut(s) 9
BstSCI CCNGG 1 cut(s) 7
CviJI RGCY 3 cut(s) 16, 100, 149
CviKI_1 RGCY 3 cut(s) 16, 100, 149
DdeI CTNAG 1 cut(s) 96
DpnI GATC 2 cut(s) 57, 122
DpnII GATC 2 cut(s) 55, 120
EcoRII CCWGG 1 cut(s) 7
FaiI YATR 2 cut(s) 46, 53
FbaI TGATCA 1 cut(s) 120
HpyCH4IV ACGT 1 cut(s) 23
HpyF10VI GCNNNNNNNGC 1 cut(s) 106
HpyF3I CTNAG 1 cut(s) 96
HpySE526I ACGT 1 cut(s) 23
Ksp22I TGATCA 1 cut(s) 120
Kzo9I GATC 2 cut(s) 55, 120
LpnPI CCDG 2 cut(s) 21, 119
LweI GCATC 1 cut(s) 21
MaeII ACGT 1 cut(s) 23
MaeIII GTNAC 1 cut(s) 36
MalI GATC 2 cut(s) 57, 122
MboI GATC 2 cut(s) 55, 120
MluCI AATT 3 cut(s) 114, 124, 160
MseI TTAA 2 cut(s) 113, 152
MspR9I CCNGG 1 cut(s) 9
MvaI CCWGG 1 cut(s) 9
MwoI GCNNNNNNNGC 1 cut(s) 106
NdeII GATC 2 cut(s) 55, 120
PasI CCCWGGG 1 cut(s) 8
Psp6I CCWGG 1 cut(s) 7
PspGI CCWGG 1 cut(s) 7
SaqAI TTAA 2 cut(s) 113, 152
Sau3AI GATC 2 cut(s) 55, 120
ScrFI CCNGG 1 cut(s) 9
SetI ASST 2 cut(s) 26, 102
SfaNI GCATC 1 cut(s) 21
SgeI CNNG 4 cut(s) 20, 21, 86, 146
Sse9I AATT 3 cut(s) 114, 124, 160
StyD4I CCNGG 1 cut(s) 7
TaiI ACGT 1 cut(s) 26
TasI AATT 3 cut(s) 114, 124, 160
Tru1I TTAA 2 cut(s) 113, 152
Tru9I TTAA 2 cut(s) 113, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.