Rh1AG418600

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
64978916 .. 64979305
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG418600.1

Sequence Viewer

Length: 390 bp
ATGGTAGCTTCTGAATTTCAGATAGCTCCAATACTAGTTGCTCTTCCAAAACTGAAAGTTTTGAGCCTCCGATGCTCGAACGTCCTGCAGGAGCATTTGATCGCTATATTGGATAGTTTACATGATTCGGAAATTCTGAATATATCACATTGCCTTTTGATGGAAACTCTACCACATCTACCAGATCGACCACCTAGAAGAAGGGTCCTTACACAAATTGATCCATTAATTCTTGACAAGGCTTCTAGGTTAAAAAAATTTATAACTTGCATGCGTTTTTTTTCGTGCATCATGTGCCAGAGGGCCAGAAAAGATGAGGGGTACATGAGGTGGTATAGAAATGAACCAGGGCTAGGGAAAGAAGATGAGGTCAATTCCCTTGCTCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.88

Weight (kDa)

8.68

Isoelectric Point (pI)

60.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 263
AclWI GGATC 1 cut(s) 215
AcsI RAATTY 3 cut(s) 14, 132, 257
AfaI GTAC 1 cut(s) 323
AfiI CCNNNNNNNGG 2 cut(s) 160, 353
AhlI ACTAGT 1 cut(s) 34
AjnI CCWGG 1 cut(s) 346
AluBI AGCT 2 cut(s) 8, 26
AluI AGCT 2 cut(s) 8, 26
AlwI GGATC 1 cut(s) 215
AoxI GGCC 1 cut(s) 303
ApoI RAATTY 3 cut(s) 14, 132, 257
AseI ATTAAT 1 cut(s) 227
AspS9I GGNCC 2 cut(s) 205, 303
AvaII GGWCC 1 cut(s) 205
BarI GAAGNNNNNNTAC 2 cut(s) 193, 225
BccI CCATC 1 cut(s) 154
BcgI CGANNNNNNTGC 2 cut(s) 67, 101
BciT130I CCWGG 1 cut(s) 348
BcuI ACTAGT 1 cut(s) 34
BfaI CTAG 4 cut(s) 35, 195, 246, 353
BfmI CTRYAG 1 cut(s) 86
Bme1390I CCNGG 1 cut(s) 348
Bme18I GGWCC 1 cut(s) 205
BmgT120I GGNCC 2 cut(s) 205, 303
BmiI GGNNCC 1 cut(s) 206
BmrFI CCNGG 1 cut(s) 348
BmsI GCATC 2 cut(s) 62, 297
BsaJI CCNNGG 1 cut(s) 347
Bsc4I CCNNNNNNNGG 2 cut(s) 160, 353
Bse3DI GCAATG 1 cut(s) 148
BseBI CCWGG 1 cut(s) 348
BseDI CCNNGG 1 cut(s) 347
BseLI CCNNNNNNNGG 2 cut(s) 160, 353
BseMI GCAATG 1 cut(s) 148
BshFI GGCC 1 cut(s) 305
BslI CCNNNNNNNGG 2 cut(s) 160, 353
BsnI GGCC 1 cut(s) 305
Bsp143I GATC 3 cut(s) 99, 184, 220
BspANI GGCC 1 cut(s) 305
BspLI GGNNCC 1 cut(s) 206
BspMAI CTGCAG 1 cut(s) 90
BspPI GGATC 1 cut(s) 215
BspQI GCTCTTC 1 cut(s) 48
BsrDI GCAATG 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 347
BssMI GATC 3 cut(s) 99, 184, 220
Bst2UI CCWGG 1 cut(s) 348
Bst6I CTCTTC 1 cut(s) 48
BstAPI GCANNNNNTGC 1 cut(s) 294
BstC8I GCNNGC 1 cut(s) 272
BstKTI GATC 3 cut(s) 102, 187, 223
BstMBI GATC 3 cut(s) 99, 184, 220
BstMWI GCNNNNNNNGC 2 cut(s) 72, 294
BstNI CCWGG 1 cut(s) 348
BstNSI RCATGY 1 cut(s) 274
BstSCI CCNGG 1 cut(s) 346
BstSFI CTRYAG 1 cut(s) 86
BsuRI GGCC 1 cut(s) 305
Cac8I GCNNGC 1 cut(s) 272
Cfr13I GGNCC 2 cut(s) 205, 303
Csp6I GTAC 1 cut(s) 322
CviAII CATG 4 cut(s) 122, 271, 292, 325
CviJI RGCY 6 cut(s) 8, 26, 66, 242, 305, 352
CviKI_1 RGCY 6 cut(s) 8, 26, 66, 242, 305, 352
CviQI GTAC 1 cut(s) 322
DpnI GATC 3 cut(s) 101, 186, 222
DpnII GATC 3 cut(s) 99, 184, 220
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
Eco47I GGWCC 1 cut(s) 205
EcoO109I RGGNCCY 1 cut(s) 205
EcoRII CCWGG 1 cut(s) 346
FaeI CATG 4 cut(s) 125, 274, 295, 328
FaiI YATR 8 cut(s) 107, 123, 143, 263, 272, 293, 326, 336
FatI CATG 4 cut(s) 121, 270, 291, 324
FspBI CTAG 4 cut(s) 35, 195, 246, 353
HaeIII GGCC 1 cut(s) 305
Hin1II CATG 4 cut(s) 125, 274, 295, 328
HinfI GANTC 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 5 cut(s) 13, 21, 71, 130, 138
Hpy188III TCNNGA 1 cut(s) 233
Hpy8I GTNNAC 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 195
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 3 cut(s) 88, 270, 288
HpyF10VI GCNNNNNNNGC 2 cut(s) 72, 294
HpySE526I ACGT 1 cut(s) 81
Hsp92II CATG 4 cut(s) 125, 274, 295, 328
Kzo9I GATC 3 cut(s) 99, 184, 220
LguI GCTCTTC 1 cut(s) 48
LmnI GCTCC 3 cut(s) 31, 91, 388
LpnPI CCDG 7 cut(s) 74, 98, 195, 311, 319, 333, 360
LweI GCATC 2 cut(s) 62, 297
MaeI CTAG 4 cut(s) 35, 195, 246, 353
MaeII ACGT 1 cut(s) 81
MalI GATC 3 cut(s) 101, 186, 222
MboI GATC 3 cut(s) 99, 184, 220
MboII GAAGA 3 cut(s) 35, 210, 374
MluCI AATT 6 cut(s) 14, 132, 216, 228, 257, 373
MnlI CCTC 5 cut(s) 77, 294, 310, 321, 361
MseI TTAA 2 cut(s) 227, 251
MspR9I CCNGG 1 cut(s) 348
MvaI CCWGG 1 cut(s) 348
MwoI GCNNNNNNNGC 2 cut(s) 72, 294
NdeII GATC 3 cut(s) 99, 184, 220
NlaIII CATG 4 cut(s) 125, 274, 295, 328
NlaIV GGNNCC 1 cut(s) 206
NspI RCATGY 1 cut(s) 274
PaeI GCATGC 1 cut(s) 274
PciSI GCTCTTC 1 cut(s) 48
PfeI GAWTC 1 cut(s) 125
PpuMI RGGWCCY 1 cut(s) 205
PshBI ATTAAT 1 cut(s) 227
PsiI TTATAA 1 cut(s) 263
Psp5II RGGWCCY 1 cut(s) 205
Psp6I CCWGG 1 cut(s) 346
PspGI CCWGG 1 cut(s) 346
PspN4I GGNNCC 1 cut(s) 206
PspPI GGNCC 2 cut(s) 205, 303
PspPPI RGGWCCY 1 cut(s) 205
PstI CTGCAG 1 cut(s) 90
RsaI GTAC 1 cut(s) 323
RsaNI GTAC 1 cut(s) 322
SapI GCTCTTC 1 cut(s) 48
SaqAI TTAA 2 cut(s) 227, 251
Sau3AI GATC 3 cut(s) 99, 184, 220
Sau96I GGNCC 2 cut(s) 205, 303
SbfI CCTGCAGG 1 cut(s) 90
ScrFI CCNGG 1 cut(s) 348
SdaI CCTGCAGG 1 cut(s) 90
SetI ASST 7 cut(s) 10, 28, 84, 196, 251, 332, 372
SfaNI GCATC 2 cut(s) 62, 297
SfcI CTRYAG 1 cut(s) 86
SinI GGWCC 1 cut(s) 205
SpeI ACTAGT 1 cut(s) 34
SphI GCATGC 1 cut(s) 274
Sse8387I CCTGCAGG 1 cut(s) 90
Sse9I AATT 6 cut(s) 14, 132, 216, 228, 257, 373
SspMI CTAG 4 cut(s) 35, 195, 246, 353
StyD4I CCNGG 1 cut(s) 346
TaiI ACGT 1 cut(s) 84
TaqI TCGA 2 cut(s) 77, 187
TasI AATT 6 cut(s) 14, 132, 216, 228, 257, 373
TfiI GAWTC 1 cut(s) 125
Tru1I TTAA 2 cut(s) 227, 251
Tru9I TTAA 2 cut(s) 227, 251
TspDTI ATGAA 1 cut(s) 357
VpaK11BI GGWCC 1 cut(s) 205
VspI ATTAAT 1 cut(s) 227
XapI RAATTY 3 cut(s) 14, 132, 257
XceI RCATGY 1 cut(s) 274
XspI CTAG 4 cut(s) 35, 195, 246, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.