Rh1BG202200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0001331
Physical Location & Seq
Reverse (-)
31968723 .. 31968950
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG202200.1

Sequence Viewer

Length: 228 bp
ATGAGTGTTGGTGATGAAATTGCCAAGCTTTTTGGTGAAGTGGGTGGTGGTGGTGGTGGAAGTGACCTGGGTGGGCCTGATGGTGGAGGTTCGAGTTTTGGGGTGGTGGAAATGGCGGAGGGGCTGAGGTTGGTGGTGGGTTTGGTGGAGTTCAAGCTTTTGGTCTTGAAGAAATTCAAGGTGGGTTTGGTGAGAAATTTCAGTTTGGTGGCGGTTTGGGTGGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

7.61

Weight (kDa)

5.18

Isoelectric Point (pI)

21.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 116, 212
AcsI RAATTY 2 cut(s) 173, 196
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 3 cut(s) 154, 169, 178
AjnI CCWGG 1 cut(s) 66
AluBI AGCT 2 cut(s) 28, 157
AluI AGCT 2 cut(s) 28, 157
AoxI GGCC 1 cut(s) 74
ApoI RAATTY 2 cut(s) 173, 196
Asp700I GAANNNNTTC 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 74
AsuHPI GGTGA 3 cut(s) 23, 47, 202
BbvCI CCTCAGC 1 cut(s) 125
BccI CCATC 1 cut(s) 74
BciT130I CCWGG 1 cut(s) 68
BfaI CTAG 1 cut(s) 226
Bme1390I CCNGG 1 cut(s) 68
BmgT120I GGNCC 1 cut(s) 74
BmrFI CCNGG 1 cut(s) 68
Bpu10I CCTNAGC 1 cut(s) 125
BsaJI CCNNGG 1 cut(s) 67
Bsc4I CCNNNNNNNGG 1 cut(s) 83
BseBI CCWGG 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 83
BseMII CTCAG 1 cut(s) 116
BshFI GGCC 1 cut(s) 76
BslI CCNNNNNNNGG 1 cut(s) 83
BsnI GGCC 1 cut(s) 76
BspACI CCGC 2 cut(s) 116, 212
BspANI GGCC 1 cut(s) 76
BspCNI CTCAG 1 cut(s) 117
BssECI CCNNGG 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 68
BstDEI CTNAG 1 cut(s) 125
BstNI CCWGG 1 cut(s) 68
BstSCI CCNGG 1 cut(s) 66
BsuRI GGCC 1 cut(s) 76
Cfr13I GGNCC 1 cut(s) 74
CviJI RGCY 4 cut(s) 28, 76, 124, 157
CviKI_1 RGCY 4 cut(s) 28, 76, 124, 157
DdeI CTNAG 1 cut(s) 125
EciI GGCGGA 1 cut(s) 131
EcoRII CCWGG 1 cut(s) 66
FspBI CTAG 1 cut(s) 226
HaeIII GGCC 1 cut(s) 76
HindIII AAGCTT 2 cut(s) 26, 155
HphI GGTGA 3 cut(s) 23, 47, 202
Hpy188III TCNNGA 1 cut(s) 166
HpyF3I CTNAG 1 cut(s) 125
LpnPI CCDG 3 cut(s) 53, 80, 90
MaeI CTAG 1 cut(s) 226
MaeIII GTNAC 1 cut(s) 62
MboII GAAGA 1 cut(s) 181
MluCI AATT 3 cut(s) 18, 173, 196
MnlI CCTC 3 cut(s) 80, 112, 120
MroXI GAANNNNTTC 1 cut(s) 173
MspR9I CCNGG 1 cut(s) 68
MvaI CCWGG 1 cut(s) 68
NmuCI GTSAC 1 cut(s) 62
PdmI GAANNNNTTC 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 66
PspGI CCWGG 1 cut(s) 66
PspPI GGNCC 1 cut(s) 74
Sau96I GGNCC 1 cut(s) 74
ScrFI CCNGG 1 cut(s) 68
SetI ASST 6 cut(s) 30, 69, 91, 131, 159, 183
SgeI CNNG 8 cut(s) 37, 79, 80, 89, 105, 166, 178, 190
Sse9I AATT 3 cut(s) 18, 173, 196
SsiI CCGC 2 cut(s) 116, 212
SspMI CTAG 1 cut(s) 226
StyD4I CCNGG 1 cut(s) 66
TaqI TCGA 1 cut(s) 92
TasI AATT 3 cut(s) 18, 173, 196
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 1 cut(s) 30
XapI RAATTY 2 cut(s) 173, 196
XmnI GAANNNNTTC 1 cut(s) 173
XspI CTAG 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.