Rh2CG241900

Protein translocase subunit SecA

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
25178435 .. 25179354
920 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG241900.1

Sequence Viewer

Length: 168 bp
ATGGTGAGGTCGCGTGAGATGCTTATGCCAAGAGTTGTAAAACTAACTGAAGGAGGTTATGTCTCAGTGAAAAAACTTATGCCGAAAAAGTCCTGGAAGGGACCTGCTTTGGATGAAGTGATATATACCCCAAATCTCAATTATTCAATTCAGTCCAGGATTGTCTAG

Protein Analysis

55

Amino Acids

6.34

Weight (kDa)

10.09

Isoelectric Point (pI)

46.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 112
AccII CGCG 1 cut(s) 13
AcuI CTGAAG 1 cut(s) 69
AgsI TTSAA 1 cut(s) 147
AjnI CCWGG 2 cut(s) 92, 155
Alw26I GTCTC 1 cut(s) 67
AspS9I GGNCC 1 cut(s) 101
AsuHPI GGTGA 1 cut(s) 16
AvaII GGWCC 1 cut(s) 101
BciT130I CCWGG 2 cut(s) 94, 157
BcoDI GTCTC 1 cut(s) 67
BfaI CTAG 1 cut(s) 166
BfuAI ACCTGC 1 cut(s) 112
Bme1390I CCNGG 2 cut(s) 94, 157
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
BmiI GGNNCC 1 cut(s) 102
BmrFI CCNGG 2 cut(s) 94, 157
BmsI GCATC 1 cut(s) 9
BsaXI ACNNNNNCTCC 2 cut(s) 45, 75
BseBI CCWGG 2 cut(s) 94, 157
BseGI GGATG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 78
Bsh1236I CGCG 1 cut(s) 13
BslFI GGGAC 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 67
BsmFI GGGAC 1 cut(s) 114
BspCNI CTCAG 1 cut(s) 77
BspFNI CGCG 1 cut(s) 13
BspLI GGNNCC 1 cut(s) 102
BspMI ACCTGC 1 cut(s) 112
Bst2UI CCWGG 2 cut(s) 94, 157
BstDEI CTNAG 1 cut(s) 64
BstF5I GGATG 1 cut(s) 118
BstFNI CGCG 1 cut(s) 13
BstMAI GTCTC 1 cut(s) 67
BstMWI GCNNNNNNNGC 1 cut(s) 19
BstNI CCWGG 2 cut(s) 94, 157
BstSCI CCNGG 2 cut(s) 92, 155
BstUI CGCG 1 cut(s) 13
BtsCI GGATG 1 cut(s) 118
BtsIMutI CAGTG 1 cut(s) 72
BveI ACCTGC 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 101
DdeI CTNAG 1 cut(s) 64
Eco47I GGWCC 1 cut(s) 101
Eco57I CTGAAG 1 cut(s) 69
EcoO109I RGGNCCY 1 cut(s) 101
EcoRII CCWGG 2 cut(s) 92, 155
FaiI YATR 5 cut(s) 26, 60, 80, 124, 126
FaqI GGGAC 1 cut(s) 114
FokI GGATG 1 cut(s) 125
FspBI CTAG 1 cut(s) 166
HphI GGTGA 1 cut(s) 16
HpyAV CCTTC 2 cut(s) 44, 91
HpyF10VI GCNNNNNNNGC 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 64
LpnPI CCDG 4 cut(s) 79, 106, 117, 142
LweI GCATC 1 cut(s) 9
MaeI CTAG 1 cut(s) 166
MluCI AATT 2 cut(s) 139, 147
MnlI CCTC 1 cut(s) 47
MspR9I CCNGG 2 cut(s) 94, 157
MvaI CCWGG 2 cut(s) 94, 157
MvnI CGCG 1 cut(s) 13
MwoI GCNNNNNNNGC 1 cut(s) 19
NlaIV GGNNCC 1 cut(s) 102
PfoI TCCNGGA 2 cut(s) 92, 155
PpuMI RGGWCCY 1 cut(s) 101
Psp5II RGGWCCY 1 cut(s) 101
Psp6I CCWGG 2 cut(s) 92, 155
PspGI CCWGG 2 cut(s) 92, 155
PspN4I GGNNCC 1 cut(s) 102
PspPI GGNCC 1 cut(s) 101
PspPPI RGGWCCY 1 cut(s) 101
Sau96I GGNCC 1 cut(s) 101
ScrFI CCNGG 2 cut(s) 94, 157
SetI ASST 3 cut(s) 11, 58, 106
SfaNI GCATC 1 cut(s) 9
SgeI CNNG 6 cut(s) 24, 26, 42, 105, 106, 116
SinI GGWCC 1 cut(s) 101
Sse9I AATT 2 cut(s) 139, 147
SspMI CTAG 1 cut(s) 166
StyD4I CCNGG 2 cut(s) 92, 155
TasI AATT 2 cut(s) 139, 147
TscAI CASTG 1 cut(s) 72
TspDTI ATGAA 1 cut(s) 129
TspRI CASTG 1 cut(s) 72
VpaK11BI GGWCC 1 cut(s) 101
XspI CTAG 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.