Rh1BG258500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0001886
Physical Location & Seq
Forward (+)
39013492 .. 39033831
20340 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG258500.1

Sequence Viewer

Length: 153 bp
ATGGCGGTGAAGATTCAAGAGTACCGAGCCACTGTACCGGAGCAACTCAAGAACACGCTGCCTTCCATTATCGAAGCTCAGAGACCCGTTTTGGCTGATGGGTCGGAGCCTGGGACGTCCGGGGATCCGAATTCGGGTTTGATTATTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.33

Weight (kDa)

4.62

Isoelectric Point (pI)

55.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 119
AciI CCGC 1 cut(s) 5
AclWI GGATC 2 cut(s) 119, 132
AcsI RAATTY 1 cut(s) 130
AcyI GRCGYC 1 cut(s) 116
AfaI GTAC 2 cut(s) 23, 36
AfiI CCNNNNNNNGG 1 cut(s) 134
AgsI TTSAA 1 cut(s) 17
AjnI CCWGG 1 cut(s) 109
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
Alw26I GTCTC 1 cut(s) 76
AlwI GGATC 2 cut(s) 119, 132
ApeKI GCWGC 1 cut(s) 58
ApoI RAATTY 1 cut(s) 130
AsuC2I CCSGG 1 cut(s) 121
AsuHPI GGTGA 1 cut(s) 19
BamHI GGATCC 1 cut(s) 124
BbvI GCAGC 1 cut(s) 45
BccI CCATC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 111
BcnI CCSGG 1 cut(s) 121
BcoDI GTCTC 1 cut(s) 76
BisI GCNGC 1 cut(s) 59
BlsI GCNGC 1 cut(s) 60
Bme1390I CCNGG 2 cut(s) 111, 121
BmiI GGNNCC 2 cut(s) 108, 126
BmrFI CCNGG 2 cut(s) 111, 121
BpuEI CTTGAG 1 cut(s) 32
BpuMI CCSGG 1 cut(s) 121
BsaHI GRCGYC 1 cut(s) 116
BsaI GGTCTC 1 cut(s) 76
BsaJI CCNNGG 2 cut(s) 110, 120
BsaWI WCCGGW 1 cut(s) 37
Bsc4I CCNNNNNNNGG 1 cut(s) 134
BseBI CCWGG 1 cut(s) 111
BseDI CCNNGG 2 cut(s) 110, 120
BseLI CCNNNNNNNGG 1 cut(s) 134
BseMII CTCAG 1 cut(s) 92
BseXI GCAGC 1 cut(s) 45
BsiSI CCGG 2 cut(s) 38, 120
BslFI GGGAC 1 cut(s) 127
BslI CCNNNNNNNGG 1 cut(s) 134
BsmAI GTCTC 1 cut(s) 76
BsmFI GGGAC 1 cut(s) 127
Bso31I GGTCTC 1 cut(s) 76
Bsp143I GATC 1 cut(s) 124
BspACI CCGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 91
BspLI GGNNCC 2 cut(s) 108, 126
BspPI GGATC 2 cut(s) 119, 132
BspTNI GGTCTC 1 cut(s) 76
BssECI CCNNGG 2 cut(s) 110, 120
BssMI GATC 1 cut(s) 124
BssNI GRCGYC 1 cut(s) 116
Bst2UI CCWGG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 34
BstACI GRCGYC 1 cut(s) 116
BstDEI CTNAG 1 cut(s) 78
BstKTI GATC 1 cut(s) 127
BstMAI GTCTC 1 cut(s) 76
BstMBI GATC 1 cut(s) 124
BstNI CCWGG 1 cut(s) 111
BstSCI CCNGG 2 cut(s) 109, 119
BstV1I GCAGC 1 cut(s) 45
BstX2I RGATCY 1 cut(s) 124
BstYI RGATCY 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 30
Csp6I GTAC 2 cut(s) 22, 35
CviJI RGCY 4 cut(s) 29, 77, 95, 109
CviKI_1 RGCY 4 cut(s) 29, 77, 95, 109
CviQI GTAC 2 cut(s) 22, 35
DdeI CTNAG 1 cut(s) 78
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
Eco31I GGTCTC 1 cut(s) 76
EcoRI GAATTC 1 cut(s) 130
EcoRII CCWGG 1 cut(s) 109
FaqI GGGAC 1 cut(s) 127
Fnu4HI GCNGC 1 cut(s) 59
Fsp4HI GCNGC 1 cut(s) 59
GluI GCNGC 1 cut(s) 59
HapII CCGG 2 cut(s) 38, 120
Hin1I GRCGYC 1 cut(s) 116
HinfI GANTC 1 cut(s) 13
HpaII CCGG 2 cut(s) 38, 120
HphI GGTGA 1 cut(s) 19
Hpy188I TCNGA 3 cut(s) 81, 106, 129
Hpy188III TCNNGA 2 cut(s) 17, 49
HpyAV CCTTC 1 cut(s) 72
HpyCH4III ACNGT 1 cut(s) 34
HpyCH4IV ACGT 1 cut(s) 116
HpyF3I CTNAG 1 cut(s) 78
HpySE526I ACGT 1 cut(s) 116
Hsp92I GRCGYC 1 cut(s) 116
Kzo9I GATC 1 cut(s) 124
LmnI GCTCC 2 cut(s) 40, 106
LpnPI CCDG 4 cut(s) 51, 96, 123, 133
Lsp1109I GCAGC 1 cut(s) 45
MaeII ACGT 1 cut(s) 116
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 1 cut(s) 22
MflI RGATCY 1 cut(s) 124
MluCI AATT 1 cut(s) 130
MmeI TCCRAC 1 cut(s) 84
MspI CCGG 2 cut(s) 38, 120
MspR9I CCNGG 2 cut(s) 111, 121
MvaI CCWGG 1 cut(s) 111
NciI CCSGG 1 cut(s) 121
NdeII GATC 1 cut(s) 124
NlaIV GGNNCC 2 cut(s) 108, 126
PfeI GAWTC 1 cut(s) 13
PkrI GCNGC 1 cut(s) 60
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
PspN4I GGNNCC 2 cut(s) 108, 126
PsuI RGATCY 1 cut(s) 124
RsaI GTAC 2 cut(s) 23, 36
RsaNI GTAC 2 cut(s) 22, 35
SatI GCNGC 1 cut(s) 59
Sau3AI GATC 1 cut(s) 124
ScrFI CCNGG 2 cut(s) 111, 121
SetI ASST 2 cut(s) 79, 119
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
Sse9I AATT 1 cut(s) 130
SsiI CCGC 1 cut(s) 5
StyD4I CCNGG 2 cut(s) 109, 119
TaaI ACNGT 1 cut(s) 34
TaiI ACGT 1 cut(s) 119
TaqI TCGA 1 cut(s) 72
TasI AATT 1 cut(s) 130
TfiI GAWTC 1 cut(s) 13
TscAI CASTG 1 cut(s) 37
TseI GCWGC 1 cut(s) 58
TspRI CASTG 1 cut(s) 37
XapI RAATTY 1 cut(s) 130
ZraI GACGTC 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.