Rh1CG096400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0001886
Physical Location & Seq
Forward (+)
20670954 .. 20682175
11222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG096400.1

Sequence Viewer

Length: 228 bp
ATGGCCTCCAGCCCAGACGCCGACGAGCTGGACGAGTTGGAATGCCAAGTCACCGAAATGGCGGTGAAGATTCAAGTGTACCGAGCCATTGTACCGGAGCAGCTCAAAAACACGCTGCCTTCCATTATCGAAGATCAGAGACCCGTTTCGGCTGATGGGTCGGAGCCTGTGACGTCCGGCGATCCGAATTCGGGTGTACTTGCACTTGTTGGCTCTGTAGGACCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

7.87

Weight (kDa)

4.05

Isoelectric Point (pI)

44.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 176
AciI CCGC 1 cut(s) 62
AclWI GGATC 1 cut(s) 176
AcsI RAATTY 1 cut(s) 187
AcyI GRCGYC 2 cut(s) 18, 173
AfaI GTAC 3 cut(s) 80, 93, 198
AfiI CCNNNNNNNGG 1 cut(s) 191
AgsI TTSAA 1 cut(s) 74
AluBI AGCT 2 cut(s) 28, 103
AluI AGCT 2 cut(s) 28, 103
Alw26I GTCTC 1 cut(s) 133
AlwI GGATC 1 cut(s) 176
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 100, 115
ApoI RAATTY 1 cut(s) 187
AspS9I GGNCC 1 cut(s) 221
AsuHPI GGTGA 2 cut(s) 43, 76
AvaII GGWCC 1 cut(s) 221
BbvI GCAGC 2 cut(s) 102, 112
BccI CCATC 1 cut(s) 149
BcoDI GTCTC 1 cut(s) 133
BfmI CTRYAG 1 cut(s) 216
BisI GCNGC 2 cut(s) 101, 116
BlsI GCNGC 2 cut(s) 102, 117
Bme18I GGWCC 1 cut(s) 221
BmgT120I GGNCC 1 cut(s) 221
BmiI GGNNCC 1 cut(s) 165
BsaHI GRCGYC 2 cut(s) 18, 173
BsaI GGTCTC 1 cut(s) 133
BsaWI WCCGGW 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 191
BseLI CCNNNNNNNGG 1 cut(s) 191
BseXI GCAGC 2 cut(s) 102, 112
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 2 cut(s) 95, 177
BslI CCNNNNNNNGG 1 cut(s) 191
BsmAI GTCTC 1 cut(s) 133
BsmI GAATGC 1 cut(s) 47
BsnI GGCC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 133
Bsp143I GATC 2 cut(s) 133, 181
BspACI CCGC 1 cut(s) 62
BspANI GGCC 1 cut(s) 5
BspLI GGNNCC 1 cut(s) 165
BspPI GGATC 1 cut(s) 176
BspTNI GGTCTC 1 cut(s) 133
BssMI GATC 2 cut(s) 133, 181
BssNI GRCGYC 2 cut(s) 18, 173
BstACI GRCGYC 2 cut(s) 18, 173
BstKTI GATC 2 cut(s) 136, 184
BstMAI GTCTC 1 cut(s) 133
BstMBI GATC 2 cut(s) 133, 181
BstSFI CTRYAG 1 cut(s) 216
BstV1I GCAGC 2 cut(s) 102, 112
BsuRI GGCC 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 221
CseI GACGC 1 cut(s) 26
Csp6I GTAC 3 cut(s) 79, 92, 197
CviJI RGCY 8 cut(s) 5, 12, 28, 86, 103, 152, 166, 213
CviKI_1 RGCY 8 cut(s) 5, 12, 28, 86, 103, 152, 166, 213
CviQI GTAC 3 cut(s) 79, 92, 197
DpnI GATC 2 cut(s) 135, 183
DpnII GATC 2 cut(s) 133, 181
Eco31I GGTCTC 1 cut(s) 133
Eco47I GGWCC 1 cut(s) 221
EcoO109I RGGNCCY 1 cut(s) 221
EcoRI GAATTC 1 cut(s) 187
Fnu4HI GCNGC 2 cut(s) 101, 116
Fsp4HI GCNGC 2 cut(s) 101, 116
GluI GCNGC 2 cut(s) 101, 116
HaeIII GGCC 1 cut(s) 5
HapII CCGG 2 cut(s) 95, 177
HgaI GACGC 1 cut(s) 26
Hin1I GRCGYC 2 cut(s) 18, 173
HinfI GANTC 1 cut(s) 70
HpaII CCGG 2 cut(s) 95, 177
HphI GGTGA 2 cut(s) 43, 76
Hpy166II GTNNAC 2 cut(s) 79, 197
Hpy188I TCNGA 3 cut(s) 138, 163, 186
Hpy8I GTNNAC 2 cut(s) 79, 197
Hpy99I CGWCG 1 cut(s) 26
HpyAV CCTTC 1 cut(s) 129
HpyCH4IV ACGT 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 203
HpySE526I ACGT 1 cut(s) 173
Hsp92I GRCGYC 2 cut(s) 18, 173
Kzo9I GATC 2 cut(s) 133, 181
LmnI GCTCC 2 cut(s) 97, 163
LpnPI CCDG 6 cut(s) 14, 22, 27, 108, 180, 190
Lsp1109I GCAGC 2 cut(s) 102, 112
MaeII ACGT 1 cut(s) 173
MaeIII GTNAC 2 cut(s) 49, 169
MalI GATC 2 cut(s) 135, 183
MboI GATC 2 cut(s) 133, 181
MboII GAAGA 2 cut(s) 79, 143
MluCI AATT 1 cut(s) 187
MmeI TCCRAC 2 cut(s) 18, 141
MnlI CCTC 1 cut(s) 16
MslI CAYNNNNRTG 1 cut(s) 56
MspI CCGG 2 cut(s) 95, 177
Mva1269I GAATGC 1 cut(s) 47
NdeII GATC 2 cut(s) 133, 181
NlaIV GGNNCC 1 cut(s) 165
NmuCI GTSAC 2 cut(s) 49, 169
PcsI WCGNNNNNNNCGW 1 cut(s) 30
PctI GAATGC 1 cut(s) 47
PfeI GAWTC 1 cut(s) 70
PkrI GCNGC 2 cut(s) 102, 117
PpuMI RGGWCCY 1 cut(s) 221
Psp5II RGGWCCY 1 cut(s) 221
PspN4I GGNNCC 1 cut(s) 165
PspPI GGNCC 1 cut(s) 221
PspPPI RGGWCCY 1 cut(s) 221
RsaI GTAC 3 cut(s) 80, 93, 198
RsaNI GTAC 3 cut(s) 79, 92, 197
RseI CAYNNNNRTG 1 cut(s) 56
SatI GCNGC 2 cut(s) 101, 116
Sau3AI GATC 2 cut(s) 133, 181
Sau96I GGNCC 1 cut(s) 221
SetI ASST 4 cut(s) 30, 105, 176, 226
SfcI CTRYAG 1 cut(s) 216
SinI GGWCC 1 cut(s) 221
SmiMI CAYNNNNRTG 1 cut(s) 56
Sse9I AATT 1 cut(s) 187
SsiI CCGC 1 cut(s) 62
TaiI ACGT 1 cut(s) 176
TaqI TCGA 1 cut(s) 129
TasI AATT 1 cut(s) 187
TatI WGTACW 1 cut(s) 196
TfiI GAWTC 1 cut(s) 70
TseFI GTSAC 2 cut(s) 49, 169
TseI GCWGC 2 cut(s) 100, 115
Tsp45I GTSAC 2 cut(s) 49, 169
VpaK11BI GGWCC 1 cut(s) 221
XapI RAATTY 1 cut(s) 187
ZraI GACGTC 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.