Rh3BG282500

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
28062555 .. 28064045
1491 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG282500.1

Sequence Viewer

Length: 255 bp
ATGGCTCATGGAATCCTTCAATCTCGTGATAATGAGAATATGGAGATGGAAGATGTCGGCGAGCAATATTTTAAAGAATTATGGGCGAGATCATTCTTTGAAAATGTGGAAATTGAGGATGAACTTGATATGCTCTTCTACAATTTTTCTATGCATGATCTTATCTATGACCTTGTACAGTCAATTGGGCAAGATGAGTGGTCTGTTGTAGATTCTAGCACTAAAGACATTGTTGAAAATATTGGATTACAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.93

Weight (kDa)

4.05

Isoelectric Point (pI)

66.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_DRP PF23559 1 - 59 8e-14 Disease resistance protein Winged helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 177
AgsI TTSAA 3 cut(s) 20, 101, 236
BauI CACGAG 1 cut(s) 24
BccI CCATC 1 cut(s) 40
BfaI CTAG 1 cut(s) 216
BseGI GGATG 1 cut(s) 124
Bsp1407I TGTACA 1 cut(s) 175
Bsp143I GATC 2 cut(s) 89, 157
BspQI GCTCTTC 1 cut(s) 140
BsrGI TGTACA 1 cut(s) 175
BssMI GATC 2 cut(s) 89, 157
BssSI CACGAG 1 cut(s) 24
Bst2BI CACGAG 1 cut(s) 24
Bst4CI ACNGT 2 cut(s) 180, 252
Bst6I CTCTTC 1 cut(s) 140
BstAUI TGTACA 1 cut(s) 175
BstC8I GCNNGC 1 cut(s) 62
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 2 cut(s) 92, 160
BstMBI GATC 2 cut(s) 89, 157
BtsCI GGATG 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 62
Csp6I GTAC 1 cut(s) 176
CspCI CAANNNNNGTGG 2 cut(s) 179, 214
CviAII CATG 2 cut(s) 8, 155
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
CviQI GTAC 1 cut(s) 176
DpnI GATC 2 cut(s) 91, 159
DpnII GATC 2 cut(s) 89, 157
DraI TTTAAA 1 cut(s) 73
Eam1104I CTCTTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 140
EcoT22I ATGCAT 1 cut(s) 156
FaeI CATG 2 cut(s) 11, 158
FaiI YATR 7 cut(s) 9, 41, 82, 131, 152, 156, 168
FatI CATG 2 cut(s) 7, 154
FokI GGATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 216
Hin1II CATG 2 cut(s) 11, 158
HinfI GANTC 2 cut(s) 12, 212
Hpy188III TCNNGA 1 cut(s) 26
HpyAV CCTTC 1 cut(s) 26
HpyCH4III ACNGT 2 cut(s) 180, 252
HpyCH4V TGCA 1 cut(s) 154
Hsp92II CATG 2 cut(s) 11, 158
Kzo9I GATC 2 cut(s) 89, 157
LguI GCTCTTC 1 cut(s) 140
MaeI CTAG 1 cut(s) 216
MalI GATC 2 cut(s) 91, 159
MboI GATC 2 cut(s) 89, 157
MboII GAAGA 2 cut(s) 62, 127
MfeI CAATTG 1 cut(s) 183
MluCI AATT 4 cut(s) 77, 111, 142, 183
MnlI CCTC 1 cut(s) 109
Mph1103I ATGCAT 1 cut(s) 156
MseI TTAA 1 cut(s) 72
MunI CAATTG 1 cut(s) 183
NdeII GATC 2 cut(s) 89, 157
NlaIII CATG 2 cut(s) 11, 158
NsiI ATGCAT 1 cut(s) 156
PciSI GCTCTTC 1 cut(s) 140
PfeI GAWTC 2 cut(s) 12, 212
RsaI GTAC 1 cut(s) 177
RsaNI GTAC 1 cut(s) 176
SapI GCTCTTC 1 cut(s) 140
SaqAI TTAA 1 cut(s) 72
Sau3AI GATC 2 cut(s) 89, 157
SetI ASST 1 cut(s) 174
Sse9I AATT 4 cut(s) 77, 111, 142, 183
SspI AATATT 2 cut(s) 68, 241
SspMI CTAG 1 cut(s) 216
TaaI ACNGT 2 cut(s) 180, 252
TasI AATT 4 cut(s) 77, 111, 142, 183
TatI WGTACW 1 cut(s) 175
TfiI GAWTC 2 cut(s) 12, 212
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
TspDTI ATGAA 1 cut(s) 135
XspI CTAG 1 cut(s) 216
Zsp2I ATGCAT 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.