Rh3BG283100

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
28122508 .. 28126508
4001 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG283100.1

Sequence Viewer

Length: 453 bp
ATGGCTCATGGAATCCTTCAATCTCATGATAATGAGAATCTGGAGATGGAAGATGTTGGGGAGCAATATTTTAAAGAATTATGGGCGAGATCGTTCTTTGAAAATGTGAAAATTGATGAGGATGCATATCATTCAATCGGGCAAGATGAGTGGTCTGTTGTGGATTCTTGCACTAAAGACATAGTTGAAAATGTTAGACACTTAAATTTAATTTCTTTACCCCGCGAGATGAGTTATCTTGCTACATTACGCATTTTGTTAATAGTTGATTGTGAGCAACTCAATCTGGTGAACCAACATTATCAAGCAATTCCATTGAGGCTTGAAAAGTTGGGTATTGGTGGACTACCACGGATCACCGAGTTGCCTGAATGGTTTCAAGGAGCTGCCAACACCCTACAGGACTTTAATTGGGTATGGCATGGGAACTTATGGGTATTGAGCCAAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

150

Amino Acids

17.48

Weight (kDa)

4.62

Isoelectric Point (pI)

42.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_DRP PF23559 1 - 40 2e-08 Disease resistance protein Winged helix domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 225
AciI CCGC 1 cut(s) 223
AclWI GGATC 1 cut(s) 362
AcsI RAATTY 1 cut(s) 205
AgsI TTSAA 6 cut(s) 20, 101, 135, 188, 326, 380
AluBI AGCT 1 cut(s) 386
AluI AGCT 1 cut(s) 386
AlwI GGATC 1 cut(s) 362
ApeKI GCWGC 1 cut(s) 386
ApoI RAATTY 1 cut(s) 205
Asp700I GAANNNNTTC 1 cut(s) 375
AsuHPI GGTGA 2 cut(s) 301, 349
BbvI GCAGC 1 cut(s) 373
BccI CCATC 1 cut(s) 40
BfaI CTAG 1 cut(s) 451
BfmI CTRYAG 1 cut(s) 398
BisI GCNGC 1 cut(s) 387
BlsI GCNGC 1 cut(s) 388
BmsI GCATC 1 cut(s) 112
BpmI CTGGAG 1 cut(s) 62
BsaBI GATNNNNATC 1 cut(s) 126
BsaJI CCNNGG 1 cut(s) 350
Bse8I GATNNNNATC 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 350
BseGI GGATG 1 cut(s) 127
BseJI GATNNNNATC 1 cut(s) 126
BseXI GCAGC 1 cut(s) 373
Bsh1236I CGCG 1 cut(s) 225
Bsp143I GATC 2 cut(s) 89, 354
BspACI CCGC 1 cut(s) 223
BspFNI CGCG 1 cut(s) 225
BspHI TCATGA 1 cut(s) 25
BspPI GGATC 1 cut(s) 362
BssECI CCNNGG 1 cut(s) 350
BssMI GATC 2 cut(s) 89, 354
BstDSI CCRYGG 1 cut(s) 350
BstF5I GGATG 1 cut(s) 127
BstFNI CGCG 1 cut(s) 225
BstKTI GATC 2 cut(s) 92, 357
BstMBI GATC 2 cut(s) 89, 354
BstSFI CTRYAG 1 cut(s) 398
BstUI CGCG 1 cut(s) 225
BstV1I GCAGC 1 cut(s) 373
BtgI CCRYGG 1 cut(s) 350
BtsCI GGATG 1 cut(s) 127
CciI TCATGA 1 cut(s) 25
CspCI CAANNNNNGTGG 2 cut(s) 131, 166
CviAII CATG 3 cut(s) 8, 26, 422
CviJI RGCY 4 cut(s) 5, 322, 386, 444
CviKI_1 RGCY 4 cut(s) 5, 322, 386, 444
DpnI GATC 2 cut(s) 91, 356
DpnII GATC 2 cut(s) 89, 354
DraI TTTAAA 1 cut(s) 73
EcoT22I ATGCAT 1 cut(s) 127
FaeI CATG 3 cut(s) 11, 29, 425
FaiI YATR 8 cut(s) 9, 27, 82, 127, 182, 418, 423, 433
FatI CATG 3 cut(s) 7, 25, 421
FauI CCCGC 1 cut(s) 230
Fnu4HI GCNGC 1 cut(s) 387
FokI GGATG 1 cut(s) 134
Fsp4HI GCNGC 1 cut(s) 387
FspBI CTAG 1 cut(s) 451
GluI GCNGC 1 cut(s) 387
GsuI CTGGAG 1 cut(s) 62
Hin1II CATG 3 cut(s) 11, 29, 425
HinfI GANTC 3 cut(s) 12, 37, 164
HphI GGTGA 2 cut(s) 301, 349
Hpy166II GTNNAC 2 cut(s) 292, 344
Hpy188III TCNNGA 2 cut(s) 26, 41
Hpy8I GTNNAC 2 cut(s) 292, 344
HpyAV CCTTC 1 cut(s) 26
HpyCH4V TGCA 2 cut(s) 125, 171
Hsp92II CATG 3 cut(s) 11, 29, 425
Kzo9I GATC 2 cut(s) 89, 354
LmnI GCTCC 2 cut(s) 61, 383
LpnPI CCDG 4 cut(s) 26, 272, 381, 386
Lsp1109I GCAGC 1 cut(s) 373
LweI GCATC 1 cut(s) 112
MaeI CTAG 1 cut(s) 451
MalI GATC 2 cut(s) 91, 356
MboI GATC 2 cut(s) 89, 354
MboII GAAGA 1 cut(s) 62
MluCI AATT 6 cut(s) 77, 111, 205, 210, 309, 409
MnlI CCTC 2 cut(s) 112, 312
Mph1103I ATGCAT 1 cut(s) 127
MroXI GAANNNNTTC 1 cut(s) 375
MseI TTAA 5 cut(s) 72, 203, 209, 260, 408
MslI CAYNNNNRTG 1 cut(s) 30
MvnI CGCG 1 cut(s) 225
NdeII GATC 2 cut(s) 89, 354
NlaIII CATG 3 cut(s) 11, 29, 425
NsiI ATGCAT 1 cut(s) 127
PagI TCATGA 1 cut(s) 25
PdmI GAANNNNTTC 1 cut(s) 375
PfeI GAWTC 3 cut(s) 12, 37, 164
PkrI GCNGC 1 cut(s) 388
RseI CAYNNNNRTG 1 cut(s) 30
SaqAI TTAA 5 cut(s) 72, 203, 209, 260, 408
SatI GCNGC 1 cut(s) 387
Sau3AI GATC 2 cut(s) 89, 354
SetI ASST 1 cut(s) 388
SfaNI GCATC 1 cut(s) 112
SfcI CTRYAG 1 cut(s) 398
SmiMI CAYNNNNRTG 1 cut(s) 30
Sse9I AATT 6 cut(s) 77, 111, 205, 210, 309, 409
SsiI CCGC 1 cut(s) 223
SspI AATATT 1 cut(s) 68
SspMI CTAG 1 cut(s) 451
TasI AATT 6 cut(s) 77, 111, 205, 210, 309, 409
TfiI GAWTC 3 cut(s) 12, 37, 164
Tru1I TTAA 5 cut(s) 72, 203, 209, 260, 408
Tru9I TTAA 5 cut(s) 72, 203, 209, 260, 408
TseI GCWGC 1 cut(s) 386
TspGWI ACGGA 1 cut(s) 367
XapI RAATTY 1 cut(s) 205
XmnI GAANNNNTTC 1 cut(s) 375
XspI CTAG 1 cut(s) 451
Zsp2I ATGCAT 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.