Rh3DG328900

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
36199658 .. 36215806
16149 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG328900.1

Sequence Viewer

Length: 411 bp
ATGGCTTCAGACTATCTTCTCTTAACCCAGACTAGTTTGGCAGGTAGGCCAGTTGTGATATCAGCTGATCCTGAATTCAATAACCTCCTTTTTCAGCAAGAAGGGAGGTCTGTTAAGTTGTGGTACTTGGATACATTTTCAAAGATCTTCGTGCTGGAAGGTGAATCAAAGATAAACGCAGTTGGCATCGTTCACAAATACATAAGGAGCGCTTGCTTGAATCACTTTGGCACTGAGAGGCTTAAGGAAAAGTTGCTCCTTGAAATACAAGAATTCGTCAACAAATGTTTATGTTCTTGGTCAATTCAGGAATCTGTTGAAGTGAAACATGCTGGCTCAGTTCTAAATATCAATCCCAGCACTTATTCACATATTAGTAATGCTTATGATCTCCTGATGTTCATGTTATAG

Protein Analysis

136

Amino Acids

15.46

Weight (kDa)

6.06

Isoelectric Point (pI)

44.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 32
AclWI GGATC 1 cut(s) 62
AcsI RAATTY 2 cut(s) 74, 272
AfaI GTAC 1 cut(s) 125
AfeI AGCGCT 1 cut(s) 211
AflII CTTAAG 1 cut(s) 242
AgsI TTSAA 5 cut(s) 79, 141, 220, 263, 320
AhlI ACTAGT 1 cut(s) 32
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
AlwI GGATC 1 cut(s) 62
Aor51HI AGCGCT 1 cut(s) 211
AoxI GGCC 1 cut(s) 47
ApoI RAATTY 2 cut(s) 74, 272
AspLEI GCGC 1 cut(s) 212
AsuHPI GGTGA 1 cut(s) 173
BciVI GTATCC 1 cut(s) 124
BcuI ACTAGT 1 cut(s) 32
BfaI CTAG 1 cut(s) 33
BfoI RGCGCY 1 cut(s) 213
BfrI CTTAAG 1 cut(s) 242
BfuAI ACCTGC 1 cut(s) 32
BfuI GTATCC 1 cut(s) 124
BglII AGATCT 1 cut(s) 144
BmsI GCATC 1 cut(s) 195
Bse1I ACTGG 1 cut(s) 50
BseMII CTCAG 2 cut(s) 225, 351
BseNI ACTGG 1 cut(s) 50
BseYI CCCAGC 1 cut(s) 356
BshFI GGCC 1 cut(s) 49
BsnI GGCC 1 cut(s) 49
Bsp143I GATC 3 cut(s) 67, 144, 388
BspANI GGCC 1 cut(s) 49
BspCNI CTCAG 2 cut(s) 226, 350
BspMI ACCTGC 1 cut(s) 32
BspPI GGATC 1 cut(s) 62
BspTI CTTAAG 1 cut(s) 242
BsrI ACTGG 1 cut(s) 50
BssMI GATC 3 cut(s) 67, 144, 388
BstAFI CTTAAG 1 cut(s) 242
BstC8I GCNNGC 2 cut(s) 214, 334
BstDEI CTNAG 2 cut(s) 234, 337
BstH2I RGCGCY 1 cut(s) 213
BstHHI GCGC 1 cut(s) 212
BstKTI GATC 3 cut(s) 70, 147, 391
BstMBI GATC 3 cut(s) 67, 144, 388
BstNSI RCATGY 1 cut(s) 332
BstX2I RGATCY 1 cut(s) 144
BstYI RGATCY 1 cut(s) 144
BsuI GTATCC 1 cut(s) 124
BsuRI GGCC 1 cut(s) 49
BtsIMutI CAGTG 1 cut(s) 231
BveI ACCTGC 1 cut(s) 32
Cac8I GCNNGC 2 cut(s) 214, 334
CfoI GCGC 1 cut(s) 212
Csp6I GTAC 1 cut(s) 124
CviAII CATG 2 cut(s) 329, 403
CviJI RGCY 5 cut(s) 5, 49, 65, 241, 336
CviKI_1 RGCY 5 cut(s) 5, 49, 65, 241, 336
CviQI GTAC 1 cut(s) 124
DdeI CTNAG 2 cut(s) 234, 337
DpnI GATC 3 cut(s) 69, 146, 390
DpnII GATC 3 cut(s) 67, 144, 388
Eco32I GATATC 1 cut(s) 60
Eco47III AGCGCT 1 cut(s) 211
EcoRI GAATTC 2 cut(s) 74, 272
EcoRV GATATC 1 cut(s) 60
FaeI CATG 2 cut(s) 332, 406
FaiI YATR 7 cut(s) 203, 292, 330, 372, 387, 404, 409
FalI AAGNNNNNCTT 2 cut(s) 196, 228
FatI CATG 2 cut(s) 328, 402
FspBI CTAG 1 cut(s) 33
GlaI GCGC 1 cut(s) 211
GsaI CCCAGC 1 cut(s) 360
HaeII RGCGCY 1 cut(s) 213
HaeIII GGCC 1 cut(s) 49
HhaI GCGC 1 cut(s) 212
Hin1II CATG 2 cut(s) 332, 406
Hin6I GCGC 1 cut(s) 210
HinP1I GCGC 1 cut(s) 210
HincII GTYRAC 1 cut(s) 280
HindII GTYRAC 1 cut(s) 280
HinfI GANTC 3 cut(s) 164, 220, 311
HphI GGTGA 1 cut(s) 173
Hpy166II GTNNAC 2 cut(s) 193, 280
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 3 cut(s) 71, 308, 394
Hpy8I GTNNAC 2 cut(s) 193, 280
HpyAV CCTTC 2 cut(s) 95, 152
HpyF3I CTNAG 2 cut(s) 234, 337
Hsp92II CATG 2 cut(s) 332, 406
HspAI GCGC 1 cut(s) 210
Kzo9I GATC 3 cut(s) 67, 144, 388
LmnI GCTCC 2 cut(s) 207, 261
LpnPI CCDG 9 cut(s) 27, 41, 63, 84, 140, 293, 318, 370, 407
LweI GCATC 1 cut(s) 195
MaeI CTAG 1 cut(s) 33
MalI GATC 3 cut(s) 69, 146, 390
MboI GATC 3 cut(s) 67, 144, 388
MboII GAAGA 2 cut(s) 8, 139
MflI RGATCY 1 cut(s) 144
MluCI AATT 3 cut(s) 74, 272, 303
MnlI CCTC 3 cut(s) 95, 99, 231
MseI TTAA 3 cut(s) 23, 114, 243
MspA1I CMGCKG 1 cut(s) 65
MspCI CTTAAG 1 cut(s) 242
NdeII GATC 3 cut(s) 67, 144, 388
NlaIII CATG 2 cut(s) 332, 406
NspI RCATGY 1 cut(s) 332
PfeI GAWTC 3 cut(s) 164, 220, 311
PspFI CCCAGC 1 cut(s) 356
PsuI RGATCY 1 cut(s) 144
PvuII CAGCTG 1 cut(s) 65
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
SaqAI TTAA 3 cut(s) 23, 114, 243
Sau3AI GATC 3 cut(s) 67, 144, 388
SetI ASST 5 cut(s) 46, 67, 87, 110, 163
SfaNI GCATC 1 cut(s) 195
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
SpeI ACTAGT 1 cut(s) 32
Sse9I AATT 3 cut(s) 74, 272, 303
SspMI CTAG 1 cut(s) 33
TasI AATT 3 cut(s) 74, 272, 303
TfiI GAWTC 3 cut(s) 164, 220, 311
Tru1I TTAA 3 cut(s) 23, 114, 243
Tru9I TTAA 3 cut(s) 23, 114, 243
TscAI CASTG 1 cut(s) 238
TspDTI ATGAA 1 cut(s) 391
TspRI CASTG 1 cut(s) 238
Vha464I CTTAAG 1 cut(s) 242
XapI RAATTY 2 cut(s) 74, 272
XceI RCATGY 1 cut(s) 332
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.