AT1G55210

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0000726
Physical Location & Seq
Reverse (-)
20597734 .. 20598768
1035 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G55210.2

Sequence Viewer

Length: 564 bp
ATGGCTAAGCTCATTTTCTTCCTCGCCGTCCAAATCCTCTTTCTCGCCGTGGTTTCTTCCGCCGGAGACGGTGAAGACTTCGCTAGAACCATGGACCGGAAACTTCTTGGTCTCCACAAAAAGGAGAAACTTACCCATTTCAAAGTCTATTGGCACGATATCTTAAGCGGTCCGAACCCAACCTCCATCATGATACAACCACCGGTTACAAACAGTTCCTATTTTGGAGCCATCTCCATGATCGACAACGCTTTGACGGCCAAAGTTCCGATGAACTCCACGGTGTTGGGTCAGGCCCAAGGATTTTACGCCGGAGCGGCCCAAAAGGAGTTGGGTTTCCTGATGGCGATGAACTTTGCTTTCAAGACAGGGAAATATAACGGAAGCACGATCACGATTCTTGGCAGGAACACGGCGTTGTCGGAAGTCAGAGAAATGCCGATCGTCGGAGGAAGTGGGCTTTTCCGATTTGCTAGAGGCTATGTGGAGGCTAGGACAAAGTGGATTAATCTCAAGAACGGTGATGCTACTGTTGAGTATAGTTGTTACGTGTTGCATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

187

Amino Acids

20.62

Weight (kDa)

9.43

Isoelectric Point (pI)

20.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 45 - 184 1.5e-51 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 317
AciI CCGC 3 cut(s) 60, 168, 317
AcoI YGGCCR 1 cut(s) 258
AfiI CCNNNNNNNGG 3 cut(s) 96, 121, 446
AflII CTTAAG 1 cut(s) 163
AflIII ACRYGT 1 cut(s) 549
AgeI ACCGGT 1 cut(s) 202
AgsI TTSAA 2 cut(s) 142, 364
AjuI GAANNNNNNNTTGG 2 cut(s) 24, 56
AloI GAACNNNNNNTCC 2 cut(s) 167, 199
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
Alw26I GTCTC 2 cut(s) 60, 116
AoxI GGCC 3 cut(s) 258, 294, 318
AseI ATTAAT 1 cut(s) 507
AsiGI ACCGGT 1 cut(s) 202
AspS9I GGNCC 4 cut(s) 94, 170, 295, 319
AsuHPI GGTGA 2 cut(s) 83, 533
AvaII GGWCC 2 cut(s) 94, 170
BbsI GAAGAC 1 cut(s) 81
BccI CCATC 3 cut(s) 194, 239, 337
BceAI ACGGC 4 cut(s) 11, 32, 273, 429
BcoDI GTCTC 2 cut(s) 60, 116
BfaI CTAG 3 cut(s) 84, 474, 492
BfrI CTTAAG 1 cut(s) 163
BglI GCCNNNNNGGC 1 cut(s) 317
BisI GCNGC 1 cut(s) 318
BlpI GCTNAGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 319
Bme18I GGWCC 2 cut(s) 94, 170
BmgT120I GGNCC 4 cut(s) 94, 170, 295, 319
BmiI GGNNCC 1 cut(s) 229
BmsI GCATC 1 cut(s) 514
BpiI GAAGAC 1 cut(s) 81
Bpu1102I GCTNAGC 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 497
BsaAI YACGTR 1 cut(s) 550
BsaI GGTCTC 1 cut(s) 116
BsaJI CCNNGG 4 cut(s) 48, 90, 279, 298
BsaWI WCCGGW 2 cut(s) 96, 202
BsaXI ACNNNNNCTCC 2 cut(s) 167, 197
Bsc4I CCNNNNNNNGG 3 cut(s) 96, 121, 446
Bse118I RCCGGY 1 cut(s) 202
BseDI CCNNGG 4 cut(s) 48, 90, 279, 298
BseLI CCNNNNNNNGG 3 cut(s) 96, 121, 446
Bsh1285I CGRYCG 1 cut(s) 444
BshFI GGCC 3 cut(s) 260, 296, 320
BshTI ACCGGT 1 cut(s) 202
BsiEI CGRYCG 1 cut(s) 444
BsiSI CCGG 4 cut(s) 63, 97, 203, 312
BslI CCNNNNNNNGG 3 cut(s) 96, 121, 446
BsmAI GTCTC 2 cut(s) 60, 116
BsmBI CGTCTC 1 cut(s) 60
BsnI GGCC 3 cut(s) 260, 296, 320
Bso31I GGTCTC 1 cut(s) 116
Bsp143I GATC 3 cut(s) 240, 390, 441
Bsp1720I GCTNAGC 1 cut(s) 6
Bsp19I CCATGG 1 cut(s) 90
BspACI CCGC 3 cut(s) 60, 168, 317
BspANI GGCC 3 cut(s) 260, 296, 320
BspHI TCATGA 1 cut(s) 189
BspLI GGNNCC 1 cut(s) 229
BspTI CTTAAG 1 cut(s) 163
BspTNI GGTCTC 1 cut(s) 116
BsrBI CCGCTC 1 cut(s) 317
BsrFI RCCGGY 1 cut(s) 202
BssAI RCCGGY 1 cut(s) 202
BssECI CCNNGG 4 cut(s) 48, 90, 279, 298
BssMI GATC 3 cut(s) 240, 390, 441
BssT1I CCWWGG 2 cut(s) 90, 298
Bst4CI ACNGT 5 cut(s) 71, 215, 283, 521, 532
BstAFI CTTAAG 1 cut(s) 163
BstBAI YACGTR 1 cut(s) 550
BstDEI CTNAG 1 cut(s) 6
BstDSI CCRYGG 3 cut(s) 48, 90, 279
BstKTI GATC 3 cut(s) 243, 393, 444
BstMAI GTCTC 2 cut(s) 60, 116
BstMBI GATC 3 cut(s) 240, 390, 441
BstMCI CGRYCG 1 cut(s) 444
BstMWI GCNNNNNNNGC 2 cut(s) 257, 317
BstV2I GAAGAC 1 cut(s) 81
BstXI CCANNNNNNTGG 1 cut(s) 286
BsuRI GGCC 3 cut(s) 260, 296, 320
BtgI CCRYGG 3 cut(s) 48, 90, 279
BtgZI GCGATG 1 cut(s) 362
CciI TCATGA 1 cut(s) 189
Cfr10I RCCGGY 1 cut(s) 202
Cfr13I GGNCC 4 cut(s) 94, 170, 295, 319
CpoI CGGWCCG 1 cut(s) 170
CspAI ACCGGT 1 cut(s) 202
CspI CGGWCCG 1 cut(s) 170
CviAII CATG 3 cut(s) 91, 190, 238
CviJI RGCY 9 cut(s) 5, 10, 230, 260, 296, 320, 460, 480, 491
CviKI_1 RGCY 9 cut(s) 5, 10, 230, 260, 296, 320, 460, 480, 491
DdeI CTNAG 1 cut(s) 6
DpnI GATC 3 cut(s) 242, 392, 443
DpnII GATC 3 cut(s) 240, 390, 441
EaeI YGGCCR 1 cut(s) 258
EciI GGCGGA 1 cut(s) 49
Eco130I CCWWGG 2 cut(s) 90, 298
Eco31I GGTCTC 1 cut(s) 116
Eco32I GATATC 1 cut(s) 160
Eco47I GGWCC 2 cut(s) 94, 170
EcoRV GATATC 1 cut(s) 160
EcoT14I CCWWGG 2 cut(s) 90, 298
ErhI CCWWGG 2 cut(s) 90, 298
Esp3I CGTCTC 1 cut(s) 60
FaeI CATG 3 cut(s) 94, 193, 241
FaiI YATR 6 cut(s) 92, 191, 239, 378, 483, 540
FatI CATG 3 cut(s) 90, 189, 237
Fnu4HI GCNGC 1 cut(s) 318
Fsp4HI GCNGC 1 cut(s) 318
FspBI CTAG 3 cut(s) 84, 474, 492
GluI GCNGC 1 cut(s) 318
HaeIII GGCC 3 cut(s) 260, 296, 320
HapII CCGG 4 cut(s) 63, 97, 203, 312
Hin1II CATG 3 cut(s) 94, 193, 241
HinfI GANTC 1 cut(s) 397
HpaII CCGG 4 cut(s) 63, 97, 203, 312
HphI GGTGA 2 cut(s) 83, 533
Hpy188I TCNGA 6 cut(s) 174, 270, 424, 431, 449, 467
Hpy188III TCNNGA 5 cut(s) 190, 340, 364, 394, 514
Hpy99I CGWCG 1 cut(s) 449
HpyCH4III ACNGT 5 cut(s) 71, 215, 283, 521, 532
HpyCH4IV ACGT 1 cut(s) 549
HpyCH4V TGCA 1 cut(s) 556
HpyF10VI GCNNNNNNNGC 2 cut(s) 257, 317
HpyF3I CTNAG 1 cut(s) 6
HpySE526I ACGT 1 cut(s) 549
Hsp92II CATG 3 cut(s) 94, 193, 241
Kzo9I GATC 3 cut(s) 240, 390, 441
LmnI GCTCC 2 cut(s) 227, 314
LpnPI CCDG 8 cut(s) 76, 110, 216, 278, 325, 353, 354, 391
LweI GCATC 1 cut(s) 514
MaeI CTAG 3 cut(s) 84, 474, 492
MaeII ACGT 1 cut(s) 549
MaeIII GTNAC 2 cut(s) 205, 545
MalI GATC 3 cut(s) 242, 392, 443
MbiI CCGCTC 1 cut(s) 317
MboI GATC 3 cut(s) 240, 390, 441
MboII GAAGA 3 cut(s) 10, 48, 86
MmeI TCCRAC 2 cut(s) 402, 427
MnlI CCTC 6 cut(s) 32, 47, 193, 443, 470, 481
MseI TTAA 2 cut(s) 164, 507
MslI CAYNNNNRTG 1 cut(s) 236
MspCI CTTAAG 1 cut(s) 163
MspI CCGG 4 cut(s) 63, 97, 203, 312
MwoI GCNNNNNNNGC 2 cut(s) 257, 317
NcoI CCATGG 1 cut(s) 90
NdeII GATC 3 cut(s) 240, 390, 441
NlaIII CATG 3 cut(s) 94, 193, 241
NlaIV GGNNCC 1 cut(s) 229
PagI TCATGA 1 cut(s) 189
PfeI GAWTC 1 cut(s) 397
PinAI ACCGGT 1 cut(s) 202
PkrI GCNGC 1 cut(s) 319
Ple19I CGATCG 1 cut(s) 444
Ppu21I YACGTR 1 cut(s) 550
PshBI ATTAAT 1 cut(s) 507
PspN4I GGNNCC 1 cut(s) 229
PspPI GGNCC 4 cut(s) 94, 170, 295, 319
PvuI CGATCG 1 cut(s) 444
RseI CAYNNNNRTG 1 cut(s) 236
Rsr2I CGGWCCG 1 cut(s) 170
RsrII CGGWCCG 1 cut(s) 170
SaqAI TTAA 2 cut(s) 164, 507
SatI GCNGC 1 cut(s) 318
Sau3AI GATC 3 cut(s) 240, 390, 441
Sau96I GGNCC 4 cut(s) 94, 170, 295, 319
SetI ASST 3 cut(s) 12, 185, 552
SfaNI GCATC 1 cut(s) 514
SinI GGWCC 2 cut(s) 94, 170
SmiMI CAYNNNNRTG 1 cut(s) 236
SmlI CTYRAG 2 cut(s) 163, 512
SmoI CTYRAG 2 cut(s) 163, 512
SsiI CCGC 3 cut(s) 60, 168, 317
SspMI CTAG 3 cut(s) 84, 474, 492
StyI CCWWGG 2 cut(s) 90, 298
TaaI ACNGT 5 cut(s) 71, 215, 283, 521, 532
TaiI ACGT 1 cut(s) 552
TaqI TCGA 1 cut(s) 243
TauI GCSGC 1 cut(s) 320
TfiI GAWTC 1 cut(s) 397
Tru1I TTAA 2 cut(s) 164, 507
Tru9I TTAA 2 cut(s) 164, 507
TspDTI ATGAA 2 cut(s) 287, 365
TspGWI ACGGA 1 cut(s) 396
Vha464I CTTAAG 1 cut(s) 163
VpaK11BI GGWCC 2 cut(s) 94, 170
VspI ATTAAT 1 cut(s) 507
XspI CTAG 3 cut(s) 84, 474, 492
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.