RLG00000036937

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
86688809 .. 86689417
609 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000036937

Sequence Viewer

Length: 447 bp
ATGGCTAGAATCCTTCCCACCTCAGCATTCCGATTGCTCATAATCTCTTCCCTTCTGACTTCCTTTTCCATAATTTCTGCGGAAGATCATGAGTTTGTGAAATCCATGGACCCCGAGCTTTTCGGTTTTACCCATTTTCGCCTGTACTGGCACGAAGTTGTTGATGGTCCTAATCCCTCTGCCGTAACAATACTGCAAACACCCTCCCAGACAAGCTTCGGCCTGATAAGAATGATCGACAACCGGCTAACCCTAGGCCCCGAACGGAGCTTGAAATTTGTAGCAAGGGCTCAAGGGTTTCATGGATGTGCTTCACAAGAAGACATTAGCCTGTTGATGGCTCAGAACTGTGTTTTCATTCAGGGGAAGTATAACGGTAGCACCATAACCCTGATGGGGAGGAACCCAGTCTTCAACAAAGTGAGGGAGCTGTCTGTATCCCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

149

Amino Acids

16.54

Weight (kDa)

7.86

Isoelectric Point (pI)

31.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 44 - 146 8.2e-33 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 80
AcsI RAATTY 1 cut(s) 275
AfaI GTAC 1 cut(s) 146
AfiI CCNNNNNNNGG 2 cut(s) 337, 396
AgsI TTSAA 2 cut(s) 274, 415
AluBI AGCT 4 cut(s) 118, 216, 270, 430
AluI AGCT 4 cut(s) 118, 216, 270, 430
Ama87I CYCGRG 1 cut(s) 113
AoxI GGCC 2 cut(s) 220, 256
ApoI RAATTY 1 cut(s) 275
AspA2I CCTAGG 1 cut(s) 253
AspS9I GGNCC 3 cut(s) 109, 167, 257
AvaI CYCGRG 1 cut(s) 113
AvaII GGWCC 2 cut(s) 109, 167
AvrII CCTAGG 1 cut(s) 253
BanII GRGCYC 1 cut(s) 292
BbsI GAAGAC 2 cut(s) 327, 403
BbvCI CCTCAGC 1 cut(s) 22
BccI CCATC 3 cut(s) 158, 331, 388
BceAI ACGGC 1 cut(s) 167
BfaI CTAG 2 cut(s) 6, 254
BlnI CCTAGG 1 cut(s) 253
Bme18I GGWCC 2 cut(s) 109, 167
BmeT110I CYCGRG 1 cut(s) 113
BmgT120I GGNCC 3 cut(s) 109, 167, 257
BmiI GGNNCC 3 cut(s) 111, 259, 404
BmrI ACTGGG 1 cut(s) 401
BmuI ACTGGG 1 cut(s) 401
BpiI GAAGAC 2 cut(s) 327, 403
Bpu10I CCTNAGC 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 276
BsaJI CCNNGG 2 cut(s) 105, 253
Bsc4I CCNNNNNNNGG 2 cut(s) 337, 396
Bse118I RCCGGY 1 cut(s) 243
Bse1I ACTGG 2 cut(s) 152, 407
BseDI CCNNGG 2 cut(s) 105, 253
BseGI GGATG 1 cut(s) 311
BseLI CCNNNNNNNGG 2 cut(s) 337, 396
BseMII CTCAG 2 cut(s) 36, 356
BseNI ACTGG 2 cut(s) 152, 407
BshFI GGCC 2 cut(s) 222, 258
BsiHKCI CYCGRG 1 cut(s) 113
BsiSI CCGG 1 cut(s) 244
BslI CCNNNNNNNGG 2 cut(s) 337, 396
BsmI GAATGC 1 cut(s) 26
BsnI GGCC 2 cut(s) 222, 258
BsoBI CYCGRG 1 cut(s) 113
Bsp1286I GDGCHC 1 cut(s) 292
Bsp143I GATC 2 cut(s) 85, 234
Bsp19I CCATGG 1 cut(s) 105
BspACI CCGC 1 cut(s) 80
BspANI GGCC 2 cut(s) 222, 258
BspCNI CTCAG 2 cut(s) 35, 355
BspHI TCATGA 1 cut(s) 88
BspLI GGNNCC 3 cut(s) 111, 259, 404
BsrFI RCCGGY 1 cut(s) 243
BsrI ACTGG 2 cut(s) 152, 407
BssAI RCCGGY 1 cut(s) 243
BssECI CCNNGG 2 cut(s) 105, 253
BssMI GATC 2 cut(s) 85, 234
BssT1I CCWWGG 2 cut(s) 105, 253
Bst4CI ACNGT 2 cut(s) 350, 377
Bst6I CTCTTC 1 cut(s) 52
BstDEI CTNAG 2 cut(s) 22, 342
BstDSI CCRYGG 1 cut(s) 105
BstF5I GGATG 1 cut(s) 311
BstKTI GATC 2 cut(s) 88, 237
BstMBI GATC 2 cut(s) 85, 234
BstV2I GAAGAC 2 cut(s) 327, 403
BsuRI GGCC 2 cut(s) 222, 258
BtgI CCRYGG 1 cut(s) 105
BtsCI GGATG 1 cut(s) 311
CciI TCATGA 1 cut(s) 88
Cfr10I RCCGGY 1 cut(s) 243
Cfr13I GGNCC 3 cut(s) 109, 167, 257
Csp6I GTAC 1 cut(s) 145
CviAII CATG 3 cut(s) 89, 106, 302
CviQI GTAC 1 cut(s) 145
DdeI CTNAG 2 cut(s) 22, 342
DpnI GATC 2 cut(s) 87, 236
DpnII GATC 2 cut(s) 85, 234
Eam1104I CTCTTC 1 cut(s) 52
EarI CTCTTC 1 cut(s) 52
Eco130I CCWWGG 2 cut(s) 105, 253
Eco24I GRGCYC 1 cut(s) 292
Eco47I GGWCC 2 cut(s) 109, 167
Eco88I CYCGRG 1 cut(s) 113
EcoO109I RGGNCCY 1 cut(s) 257
EcoT14I CCWWGG 2 cut(s) 105, 253
EcoT38I GRGCYC 1 cut(s) 292
ErhI CCWWGG 2 cut(s) 105, 253
FaeI CATG 3 cut(s) 92, 109, 305
FaiI YATR 7 cut(s) 41, 71, 90, 107, 303, 372, 386
FatI CATG 3 cut(s) 88, 105, 301
FokI GGATG 1 cut(s) 318
FriOI GRGCYC 1 cut(s) 292
FspBI CTAG 2 cut(s) 6, 254
HaeIII GGCC 2 cut(s) 222, 258
HapII CCGG 1 cut(s) 244
Hin1II CATG 3 cut(s) 92, 109, 305
HindIII AAGCTT 1 cut(s) 214
HinfI GANTC 1 cut(s) 9
HpaII CCGG 1 cut(s) 244
Hpy188I TCNGA 3 cut(s) 32, 57, 345
Hpy188III TCNNGA 1 cut(s) 89
HpyAV CCTTC 2 cut(s) 23, 62
HpyCH4III ACNGT 2 cut(s) 350, 377
HpyCH4V TGCA 1 cut(s) 196
HpyF3I CTNAG 2 cut(s) 22, 342
Hsp92II CATG 3 cut(s) 92, 109, 305
Kzo9I GATC 2 cut(s) 85, 234
LmnI GCTCC 2 cut(s) 267, 427
LpnPI CCDG 9 cut(s) 133, 155, 221, 236, 257, 344, 347, 404, 420
MaeI CTAG 2 cut(s) 6, 254
MaeIII GTNAC 1 cut(s) 184
MalI GATC 2 cut(s) 87, 236
MboI GATC 2 cut(s) 85, 234
MboII GAAGA 4 cut(s) 39, 95, 332, 403
MhlI GDGCHC 1 cut(s) 292
MluCI AATT 2 cut(s) 72, 275
MnlI CCTC 5 cut(s) 31, 187, 214, 393, 417
MslI CAYNNNNRTG 1 cut(s) 306
MspI CCGG 1 cut(s) 244
Mva1269I GAATGC 1 cut(s) 26
NcoI CCATGG 1 cut(s) 105
NdeII GATC 2 cut(s) 85, 234
NlaIII CATG 3 cut(s) 92, 109, 305
NlaIV GGNNCC 3 cut(s) 111, 259, 404
PagI TCATGA 1 cut(s) 88
PctI GAATGC 1 cut(s) 26
PfeI GAWTC 1 cut(s) 9
PspN4I GGNNCC 3 cut(s) 111, 259, 404
PspPI GGNCC 3 cut(s) 109, 167, 257
RsaI GTAC 1 cut(s) 146
RsaNI GTAC 1 cut(s) 145
RseI CAYNNNNRTG 1 cut(s) 306
Sau3AI GATC 2 cut(s) 85, 234
Sau96I GGNCC 3 cut(s) 109, 167, 257
SduI GDGCHC 1 cut(s) 292
SetI ASST 5 cut(s) 23, 120, 218, 272, 432
SinI GGWCC 2 cut(s) 109, 167
SmiMI CAYNNNNRTG 1 cut(s) 306
SmlI CTYRAG 1 cut(s) 291
SmoI CTYRAG 1 cut(s) 291
Sse9I AATT 2 cut(s) 72, 275
SsiI CCGC 1 cut(s) 80
SspMI CTAG 2 cut(s) 6, 254
StyI CCWWGG 2 cut(s) 105, 253
TaaI ACNGT 2 cut(s) 350, 377
TaqI TCGA 1 cut(s) 237
TasI AATT 2 cut(s) 72, 275
TatI WGTACW 1 cut(s) 144
TfiI GAWTC 1 cut(s) 9
TspDTI ATGAA 2 cut(s) 290, 346
TspGWI ACGGA 1 cut(s) 280
VpaK11BI GGWCC 2 cut(s) 109, 167
XapI RAATTY 1 cut(s) 275
XcmI CCANNNNNNNNNTGG 1 cut(s) 391
XmaJI CCTAGG 1 cut(s) 253
XspI CTAG 2 cut(s) 6, 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.