RchiOBHm_Chr5g0081451

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000726
Physical Location & Seq
Reverse (-)
87430046 .. 87430725
680 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35570

Sequence Viewer

Length: 591 bp
ATGGCTAGAATCCTTCCCACCTTAGCTTTCCACTTGCTCATAATCTCTTCCCTCCTGTCTTCCTTTTCCATGATCTTAGTTTCTGCGGAAGATCATGAGTTTGTGCAATCCATGGACCCCGAGCTTTTCGGTTTAAAGAAAGAAAAGCTCACCCATTTTCGCATGTATTGGCACGACGTTGTTGATGGTCCTATTCCCTCTGCCGTAACAATAGTGCAACCACCCTCCAACTCCTCCCAAACACGGTTCGGCCTAATAAGAATGTTCGACAACGCTCTAACCCAAGGCCCCGAACCAAGCTCGAAACTTCTGGGAAGGGCTCAAGGGTTTTATGGATCTGCTTCACAAGAAGACATTAGCCTGTTGATGGCTCAGAACTTTGCTTTTGTTCAGGGAAAGTATAACGGTAGCACCGTAACCCTGATGGGGAGGAATTCGATCTTGAACAAAGTGAGGGAACTATCTGTGATAGGAGGAAGTGGACTTTTCAGGTATGCTAGGGGTTATGCTCTAGCAACCACTCAGTCGTTTAATGCGTCTAAAAGTGATGATGCTATAGTGGAGTATAATATCTATGTCTTGCATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

196

Amino Acids

21.72

Weight (kDa)

6.97

Isoelectric Point (pI)

40.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 51 - 193 1e-53 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 86
AclWI GGATC 1 cut(s) 343
AcsI RAATTY 1 cut(s) 433
AfiI CCNNNNNNNGG 3 cut(s) 243, 367, 426
AgsI TTSAA 1 cut(s) 445
AluBI AGCT 4 cut(s) 26, 124, 148, 300
AluI AGCT 4 cut(s) 26, 124, 148, 300
AlwI GGATC 1 cut(s) 343
Ama87I CYCGRG 1 cut(s) 119
AoxI GGCC 2 cut(s) 250, 286
ApoI RAATTY 1 cut(s) 433
AspS9I GGNCC 3 cut(s) 115, 188, 287
AsuHPI GGTGA 1 cut(s) 142
AvaI CYCGRG 1 cut(s) 119
AvaII GGWCC 2 cut(s) 115, 188
BanII GRGCYC 1 cut(s) 322
BbsI GAAGAC 2 cut(s) 51, 357
BccI CCATC 3 cut(s) 179, 361, 418
BceAI ACGGC 1 cut(s) 188
BfaI CTAG 3 cut(s) 6, 498, 512
BfmI CTRYAG 1 cut(s) 555
Bme18I GGWCC 2 cut(s) 115, 188
BmeT110I CYCGRG 1 cut(s) 119
BmgT120I GGNCC 3 cut(s) 115, 188, 287
BmiI GGNNCC 2 cut(s) 117, 289
BmsI GCATC 1 cut(s) 541
BpiI GAAGAC 2 cut(s) 51, 357
Bpu10I CCTNAGC 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 306
BsaJI CCNNGG 2 cut(s) 111, 283
Bsc4I CCNNNNNNNGG 3 cut(s) 243, 367, 426
BseDI CCNNGG 2 cut(s) 111, 283
BseLI CCNNNNNNNGG 3 cut(s) 243, 367, 426
BseMII CTCAG 2 cut(s) 386, 536
BseRI GAGGAG 1 cut(s) 223
BshFI GGCC 2 cut(s) 252, 288
BsiHKCI CYCGRG 1 cut(s) 119
BslI CCNNNNNNNGG 3 cut(s) 243, 367, 426
BsnI GGCC 2 cut(s) 252, 288
BsoBI CYCGRG 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 322
Bsp143I GATC 4 cut(s) 72, 91, 335, 438
Bsp19I CCATGG 1 cut(s) 111
BspACI CCGC 1 cut(s) 86
BspANI GGCC 2 cut(s) 252, 288
BspCNI CTCAG 2 cut(s) 385, 535
BspHI TCATGA 1 cut(s) 94
BspLI GGNNCC 2 cut(s) 117, 289
BspPI GGATC 1 cut(s) 343
BssECI CCNNGG 2 cut(s) 111, 283
BssMI GATC 4 cut(s) 72, 91, 335, 438
BssT1I CCWWGG 2 cut(s) 111, 283
Bst4CI ACNGT 3 cut(s) 246, 407, 415
Bst6I CTCTTC 1 cut(s) 52
BstDEI CTNAG 4 cut(s) 22, 76, 372, 522
BstDSI CCRYGG 1 cut(s) 111
BstKTI GATC 4 cut(s) 75, 94, 338, 441
BstMBI GATC 4 cut(s) 72, 91, 335, 438
BstNSI RCATGY 1 cut(s) 166
BstSFI CTRYAG 1 cut(s) 555
BstV2I GAAGAC 2 cut(s) 51, 357
BstX2I RGATCY 1 cut(s) 335
BstYI RGATCY 1 cut(s) 335
BsuRI GGCC 2 cut(s) 252, 288
BtgI CCRYGG 1 cut(s) 111
CciI TCATGA 1 cut(s) 94
Cfr13I GGNCC 3 cut(s) 115, 188, 287
CseI GACGC 1 cut(s) 525
CviAII CATG 4 cut(s) 70, 95, 112, 163
DdeI CTNAG 4 cut(s) 22, 76, 372, 522
DpnI GATC 4 cut(s) 74, 93, 337, 440
DpnII GATC 4 cut(s) 72, 91, 335, 438
DraI TTTAAA 1 cut(s) 135
Eam1104I CTCTTC 1 cut(s) 52
EarI CTCTTC 1 cut(s) 52
Eco130I CCWWGG 2 cut(s) 111, 283
Eco24I GRGCYC 1 cut(s) 322
Eco47I GGWCC 2 cut(s) 115, 188
Eco88I CYCGRG 1 cut(s) 119
EcoO109I RGGNCCY 1 cut(s) 287
EcoRI GAATTC 1 cut(s) 433
EcoT14I CCWWGG 2 cut(s) 111, 283
EcoT38I GRGCYC 1 cut(s) 322
ErhI CCWWGG 2 cut(s) 111, 283
FaeI CATG 4 cut(s) 73, 98, 115, 166
FatI CATG 4 cut(s) 69, 94, 111, 162
FriOI GRGCYC 1 cut(s) 322
FspBI CTAG 3 cut(s) 6, 498, 512
HaeIII GGCC 2 cut(s) 252, 288
HgaI GACGC 1 cut(s) 525
Hin1II CATG 4 cut(s) 73, 98, 115, 166
HinfI GANTC 1 cut(s) 9
HphI GGTGA 1 cut(s) 142
Hpy166II GTNNAC 1 cut(s) 482
Hpy188I TCNGA 1 cut(s) 375
Hpy188III TCNNGA 2 cut(s) 95, 442
Hpy8I GTNNAC 1 cut(s) 482
Hpy99I CGWCG 1 cut(s) 179
HpyAV CCTTC 2 cut(s) 23, 309
HpyCH4III ACNGT 3 cut(s) 246, 407, 415
HpyCH4IV ACGT 1 cut(s) 177
HpyCH4V TGCA 3 cut(s) 106, 217, 583
HpyF3I CTNAG 4 cut(s) 22, 76, 372, 522
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 4 cut(s) 73, 98, 115, 166
Kzo9I GATC 4 cut(s) 72, 91, 335, 438
LpnPI CCDG 6 cut(s) 68, 296, 374, 377, 434, 475
LweI GCATC 1 cut(s) 541
MaeI CTAG 3 cut(s) 6, 498, 512
MaeII ACGT 1 cut(s) 177
MaeIII GTNAC 2 cut(s) 205, 415
MalI GATC 4 cut(s) 74, 93, 337, 440
MboI GATC 4 cut(s) 72, 91, 335, 438
MboII GAAGA 4 cut(s) 39, 51, 101, 362
MflI RGATCY 1 cut(s) 335
MhlI GDGCHC 1 cut(s) 322
MluCI AATT 1 cut(s) 433
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 7 cut(s) 62, 208, 235, 244, 423, 447, 467
MseI TTAA 2 cut(s) 134, 531
NcoI CCATGG 1 cut(s) 111
NdeII GATC 4 cut(s) 72, 91, 335, 438
NlaIII CATG 4 cut(s) 73, 98, 115, 166
NlaIV GGNNCC 2 cut(s) 117, 289
NspI RCATGY 1 cut(s) 166
PagI TCATGA 1 cut(s) 94
PcsI WCGNNNNNNNCGW 2 cut(s) 411, 533
PfeI GAWTC 1 cut(s) 9
PspN4I GGNNCC 2 cut(s) 117, 289
PspPI GGNCC 3 cut(s) 115, 188, 287
PsuI RGATCY 1 cut(s) 335
SaqAI TTAA 2 cut(s) 134, 531
Sau3AI GATC 4 cut(s) 72, 91, 335, 438
Sau96I GGNCC 3 cut(s) 115, 188, 287
SduI GDGCHC 1 cut(s) 322
SetI ASST 7 cut(s) 23, 28, 126, 150, 180, 302, 494
SfaNI GCATC 1 cut(s) 541
SfcI CTRYAG 1 cut(s) 555
SinI GGWCC 2 cut(s) 115, 188
SmlI CTYRAG 1 cut(s) 321
SmoI CTYRAG 1 cut(s) 321
Sse9I AATT 1 cut(s) 433
SsiI CCGC 1 cut(s) 86
SspMI CTAG 3 cut(s) 6, 498, 512
StyI CCWWGG 2 cut(s) 111, 283
TaaI ACNGT 3 cut(s) 246, 407, 415
TaiI ACGT 1 cut(s) 180
TaqI TCGA 3 cut(s) 267, 302, 437
TasI AATT 1 cut(s) 433
TfiI GAWTC 1 cut(s) 9
Tru1I TTAA 2 cut(s) 134, 531
Tru9I TTAA 2 cut(s) 134, 531
VpaK11BI GGWCC 2 cut(s) 115, 188
XapI RAATTY 1 cut(s) 433
XceI RCATGY 1 cut(s) 166
XspI CTAG 3 cut(s) 6, 498, 512
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.