Rh5AG527900

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000726
Physical Location & Seq
Reverse (-)
90529614 .. 90530093
480 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG527900.1

Sequence Viewer

Length: 480 bp
ATGGACCCCGAGCTTTTCGGTTTAAAGAAAGAAAAGCTCACCCATTTTCGCATGTACTGGCACGACGTTGTTGATGGTCCTAATCCCTCTGCCGTAACAATAGTGCAACCACCCTCCAACTCCTCCCAAACACGCTTCGGCCTAATAAGAATGTTCGACAACGCTCTAACCCAAGGCCCCGAACCAAGCTCCAAACTTCTGGGAAGGGCTCAAGGGTTTTATGGATCTGCTTCACAAGAAGACATTAGCCTGTTGATGGCTGAGAACTTTGCTTTTGTTCAGGGAAAGTATAACGGTAGCACCATAACCCTGATGGGGAGGAATTCGATCTTGCACAAAGTGAGGGAGCTGTCTGTGATAGGAGGAAGTGGACTTTTCAGGTATGCTAGGGGTTATGCTCTAGCAACCACTCAGTCGTTTAATGCGTCTAAAAGTGATGATGCTATAGTGGAGTATAATATCTATGTCTTGCATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

159

Amino Acids

17.66

Weight (kDa)

7.97

Isoelectric Point (pI)

37.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 14 - 156 4.4e-55 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 232
AcsI RAATTY 1 cut(s) 322
AdeI CACNNNGTG 1 cut(s) 340
AfaI GTAC 1 cut(s) 56
AfiI CCNNNNNNNGG 2 cut(s) 256, 315
AluBI AGCT 4 cut(s) 13, 37, 189, 349
AluI AGCT 4 cut(s) 13, 37, 189, 349
AlwI GGATC 1 cut(s) 232
Ama87I CYCGRG 1 cut(s) 8
AoxI GGCC 2 cut(s) 139, 175
ApoI RAATTY 1 cut(s) 322
AspS9I GGNCC 3 cut(s) 4, 77, 176
AsuHPI GGTGA 1 cut(s) 31
AvaI CYCGRG 1 cut(s) 8
AvaII GGWCC 2 cut(s) 4, 77
BanII GRGCYC 1 cut(s) 211
BbsI GAAGAC 1 cut(s) 246
BccI CCATC 3 cut(s) 68, 250, 307
BceAI ACGGC 1 cut(s) 77
BfaI CTAG 2 cut(s) 387, 401
BfmI CTRYAG 1 cut(s) 444
Bme18I GGWCC 2 cut(s) 4, 77
BmeT110I CYCGRG 1 cut(s) 8
BmgT120I GGNCC 3 cut(s) 4, 77, 176
BmiI GGNNCC 2 cut(s) 6, 178
BmsI GCATC 1 cut(s) 430
BpiI GAAGAC 1 cut(s) 246
BpuEI CTTGAG 1 cut(s) 195
BsaJI CCNNGG 1 cut(s) 172
Bsc4I CCNNNNNNNGG 2 cut(s) 256, 315
Bse1I ACTGG 1 cut(s) 62
BseDI CCNNGG 1 cut(s) 172
BseLI CCNNNNNNNGG 2 cut(s) 256, 315
BseMII CTCAG 2 cut(s) 252, 425
BseNI ACTGG 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 112
BshFI GGCC 2 cut(s) 141, 177
BsiHKCI CYCGRG 1 cut(s) 8
BslI CCNNNNNNNGG 2 cut(s) 256, 315
BsnI GGCC 2 cut(s) 141, 177
BsoBI CYCGRG 1 cut(s) 8
Bsp1286I GDGCHC 1 cut(s) 211
Bsp143I GATC 2 cut(s) 224, 327
BspANI GGCC 2 cut(s) 141, 177
BspCNI CTCAG 2 cut(s) 253, 424
BspLI GGNNCC 2 cut(s) 6, 178
BspPI GGATC 1 cut(s) 232
BsrI ACTGG 1 cut(s) 62
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 2 cut(s) 224, 327
BssT1I CCWWGG 1 cut(s) 172
Bst4CI ACNGT 1 cut(s) 296
BstDEI CTNAG 2 cut(s) 261, 411
BstKTI GATC 2 cut(s) 227, 330
BstMBI GATC 2 cut(s) 224, 327
BstNSI RCATGY 1 cut(s) 55
BstSFI CTRYAG 1 cut(s) 444
BstV2I GAAGAC 1 cut(s) 246
BstX2I RGATCY 1 cut(s) 224
BstXI CCANNNNNNTGG 1 cut(s) 199
BstYI RGATCY 1 cut(s) 224
BsuRI GGCC 2 cut(s) 141, 177
Cfr13I GGNCC 3 cut(s) 4, 77, 176
CseI GACGC 1 cut(s) 414
Csp6I GTAC 1 cut(s) 55
CviAII CATG 1 cut(s) 52
CviJI RGCY 9 cut(s) 13, 37, 141, 177, 189, 209, 249, 260, 349
CviKI_1 RGCY 9 cut(s) 13, 37, 141, 177, 189, 209, 249, 260, 349
CviQI GTAC 1 cut(s) 55
DdeI CTNAG 2 cut(s) 261, 411
DpnI GATC 2 cut(s) 226, 329
DpnII GATC 2 cut(s) 224, 327
DraI TTTAAA 1 cut(s) 24
DraIII CACNNNGTG 1 cut(s) 340
Eco130I CCWWGG 1 cut(s) 172
Eco24I GRGCYC 1 cut(s) 211
Eco47I GGWCC 2 cut(s) 4, 77
Eco88I CYCGRG 1 cut(s) 8
EcoO109I RGGNCCY 1 cut(s) 176
EcoRI GAATTC 1 cut(s) 322
EcoT14I CCWWGG 1 cut(s) 172
EcoT38I GRGCYC 1 cut(s) 211
ErhI CCWWGG 1 cut(s) 172
FaeI CATG 1 cut(s) 55
FaiI YATR 9 cut(s) 53, 222, 291, 305, 384, 396, 446, 456, 465
FatI CATG 1 cut(s) 51
FriOI GRGCYC 1 cut(s) 211
FspBI CTAG 2 cut(s) 387, 401
HaeIII GGCC 2 cut(s) 141, 177
HgaI GACGC 1 cut(s) 414
Hin1II CATG 1 cut(s) 55
HphI GGTGA 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 371
Hpy8I GTNNAC 1 cut(s) 371
Hpy99I CGWCG 1 cut(s) 68
HpyAV CCTTC 1 cut(s) 198
HpyCH4III ACNGT 1 cut(s) 296
HpyCH4IV ACGT 1 cut(s) 66
HpyCH4V TGCA 3 cut(s) 106, 334, 472
HpyF3I CTNAG 2 cut(s) 261, 411
HpySE526I ACGT 1 cut(s) 66
Hsp92II CATG 1 cut(s) 55
Kzo9I GATC 2 cut(s) 224, 327
LmnI GCTCC 2 cut(s) 194, 346
LpnPI CCDG 6 cut(s) 43, 185, 263, 266, 323, 364
LweI GCATC 1 cut(s) 430
MaeI CTAG 2 cut(s) 387, 401
MaeII ACGT 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 94
MalI GATC 2 cut(s) 226, 329
MboI GATC 2 cut(s) 224, 327
MboII GAAGA 1 cut(s) 251
MflI RGATCY 1 cut(s) 224
MhlI GDGCHC 1 cut(s) 211
MluCI AATT 1 cut(s) 322
MmeI TCCRAC 1 cut(s) 141
MnlI CCTC 6 cut(s) 97, 124, 133, 312, 336, 356
MseI TTAA 2 cut(s) 23, 420
NdeII GATC 2 cut(s) 224, 327
NlaIII CATG 1 cut(s) 55
NlaIV GGNNCC 2 cut(s) 6, 178
NspI RCATGY 1 cut(s) 55
PcsI WCGNNNNNNNCGW 1 cut(s) 422
PspN4I GGNNCC 2 cut(s) 6, 178
PspPI GGNCC 3 cut(s) 4, 77, 176
PsuI RGATCY 1 cut(s) 224
RsaI GTAC 1 cut(s) 56
RsaNI GTAC 1 cut(s) 55
SaqAI TTAA 2 cut(s) 23, 420
Sau3AI GATC 2 cut(s) 224, 327
Sau96I GGNCC 3 cut(s) 4, 77, 176
SduI GDGCHC 1 cut(s) 211
SetI ASST 6 cut(s) 15, 39, 69, 191, 351, 383
SfaNI GCATC 1 cut(s) 430
SfcI CTRYAG 1 cut(s) 444
SinI GGWCC 2 cut(s) 4, 77
SmlI CTYRAG 1 cut(s) 210
SmoI CTYRAG 1 cut(s) 210
Sse9I AATT 1 cut(s) 322
SspMI CTAG 2 cut(s) 387, 401
StyI CCWWGG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 296
TaiI ACGT 1 cut(s) 69
TaqI TCGA 2 cut(s) 156, 326
TasI AATT 1 cut(s) 322
TatI WGTACW 1 cut(s) 54
Tru1I TTAA 2 cut(s) 23, 420
Tru9I TTAA 2 cut(s) 23, 420
VpaK11BI GGWCC 2 cut(s) 4, 77
XapI RAATTY 1 cut(s) 322
XceI RCATGY 1 cut(s) 55
XcmI CCANNNNNNNNNTGG 1 cut(s) 310
XspI CTAG 2 cut(s) 387, 401
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.