Rh5DG536500

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
82772830 .. 82773159
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG536500.1

Sequence Viewer

Length: 330 bp
ATGTTCGACAACGCTCTAACCCAAGGCCCCGAACCGAGCTCGAAACTTCTGGGAAGGGCTCAAGGGTTTTATGGATCTGCTTCACAAGAAGACATTAGCCTGTTGATGGCTCAGAACTTTGCTCTTGTTCAGGGGAAGTATAACGGTAGCACCATAACCCTGATGGGGAGGAATTCGATCTTGAACAAAGTGAGGGAGCTGTCTGTGATAGGAGGAAGTGGACTTTTCAGGTATGCTAGGGGTTATGCTCTAGCAACCACTCAGTCGTTTAATGCGTCTAAAAGTGCTGATGCTATAGTGGAGTATAATATCTATGTCTTGCATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

11.84

Weight (kDa)

9.0

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 1 - 106 4.4e-40 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 82
AcsI RAATTY 1 cut(s) 172
AfiI CCNNNNNNNGG 2 cut(s) 106, 165
AgsI TTSAA 1 cut(s) 184
AluBI AGCT 2 cut(s) 39, 199
AluI AGCT 2 cut(s) 39, 199
Alw21I GWGCWC 1 cut(s) 41
AlwI GGATC 1 cut(s) 82
AoxI GGCC 1 cut(s) 25
ApoI RAATTY 1 cut(s) 172
AspS9I GGNCC 1 cut(s) 26
BanII GRGCYC 2 cut(s) 41, 61
BbsI GAAGAC 1 cut(s) 96
Bbv12I GWGCWC 1 cut(s) 41
BccI CCATC 2 cut(s) 100, 157
BfaI CTAG 2 cut(s) 237, 251
BfmI CTRYAG 1 cut(s) 294
BmgT120I GGNCC 1 cut(s) 26
BmiI GGNNCC 1 cut(s) 28
BmsI GCATC 1 cut(s) 280
BpiI GAAGAC 1 cut(s) 96
BpuEI CTTGAG 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 22
Bsc4I CCNNNNNNNGG 2 cut(s) 106, 165
BseDI CCNNGG 1 cut(s) 22
BseLI CCNNNNNNNGG 2 cut(s) 106, 165
BseMII CTCAG 2 cut(s) 125, 275
BshFI GGCC 1 cut(s) 27
BsiHKAI GWGCWC 1 cut(s) 41
BslI CCNNNNNNNGG 2 cut(s) 106, 165
BsnI GGCC 1 cut(s) 27
Bsp1286I GDGCHC 2 cut(s) 41, 61
Bsp143I GATC 2 cut(s) 74, 177
BspANI GGCC 1 cut(s) 27
BspCNI CTCAG 2 cut(s) 124, 274
BspLI GGNNCC 1 cut(s) 28
BspPI GGATC 1 cut(s) 82
BssECI CCNNGG 1 cut(s) 22
BssMI GATC 2 cut(s) 74, 177
BssT1I CCWWGG 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 146
BstDEI CTNAG 2 cut(s) 111, 261
BstKTI GATC 2 cut(s) 77, 180
BstMBI GATC 2 cut(s) 74, 177
BstSFI CTRYAG 1 cut(s) 294
BstV2I GAAGAC 1 cut(s) 96
BstX2I RGATCY 1 cut(s) 74
BstYI RGATCY 1 cut(s) 74
BsuRI GGCC 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 26
CseI GACGC 1 cut(s) 264
CviJI RGCY 6 cut(s) 27, 39, 59, 99, 110, 199
CviKI_1 RGCY 6 cut(s) 27, 39, 59, 99, 110, 199
DdeI CTNAG 2 cut(s) 111, 261
DpnI GATC 2 cut(s) 76, 179
DpnII GATC 2 cut(s) 74, 177
Ecl136II GAGCTC 1 cut(s) 39
Eco130I CCWWGG 1 cut(s) 22
Eco24I GRGCYC 2 cut(s) 41, 61
Eco53kI GAGCTC 1 cut(s) 39
EcoICRI GAGCTC 1 cut(s) 39
EcoO109I RGGNCCY 1 cut(s) 26
EcoRI GAATTC 1 cut(s) 172
EcoT14I CCWWGG 1 cut(s) 22
EcoT38I GRGCYC 2 cut(s) 41, 61
ErhI CCWWGG 1 cut(s) 22
FaiI YATR 8 cut(s) 72, 141, 155, 234, 246, 296, 306, 315
FriOI GRGCYC 2 cut(s) 41, 61
FspBI CTAG 2 cut(s) 237, 251
HaeIII GGCC 1 cut(s) 27
HgaI GACGC 1 cut(s) 264
Hpy166II GTNNAC 1 cut(s) 221
Hpy188I TCNGA 1 cut(s) 114
Hpy188III TCNNGA 1 cut(s) 181
Hpy8I GTNNAC 1 cut(s) 221
HpyAV CCTTC 1 cut(s) 48
HpyCH4III ACNGT 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 322
HpyF3I CTNAG 2 cut(s) 111, 261
Kzo9I GATC 2 cut(s) 74, 177
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 5 cut(s) 35, 113, 116, 173, 214
LweI GCATC 1 cut(s) 280
MaeI CTAG 2 cut(s) 237, 251
MalI GATC 2 cut(s) 76, 179
MboI GATC 2 cut(s) 74, 177
MboII GAAGA 1 cut(s) 101
MflI RGATCY 1 cut(s) 74
MhlI GDGCHC 2 cut(s) 41, 61
MluCI AATT 1 cut(s) 172
MnlI CCTC 3 cut(s) 162, 186, 206
MseI TTAA 1 cut(s) 270
NdeII GATC 2 cut(s) 74, 177
NlaIV GGNNCC 1 cut(s) 28
PcsI WCGNNNNNNNCGW 1 cut(s) 272
Psp124BI GAGCTC 1 cut(s) 41
PspN4I GGNNCC 1 cut(s) 28
PspPI GGNCC 1 cut(s) 26
PsuI RGATCY 1 cut(s) 74
SacI GAGCTC 1 cut(s) 41
SaqAI TTAA 1 cut(s) 270
Sau3AI GATC 2 cut(s) 74, 177
Sau96I GGNCC 1 cut(s) 26
SduI GDGCHC 2 cut(s) 41, 61
SetI ASST 3 cut(s) 41, 201, 233
SfaNI GCATC 1 cut(s) 280
SfcI CTRYAG 1 cut(s) 294
SmlI CTYRAG 1 cut(s) 60
SmoI CTYRAG 1 cut(s) 60
Sse9I AATT 1 cut(s) 172
SspMI CTAG 2 cut(s) 237, 251
SstI GAGCTC 1 cut(s) 41
StyI CCWWGG 1 cut(s) 22
TaaI ACNGT 1 cut(s) 146
TaqI TCGA 3 cut(s) 6, 41, 176
TasI AATT 1 cut(s) 172
Tru1I TTAA 1 cut(s) 270
Tru9I TTAA 1 cut(s) 270
XapI RAATTY 1 cut(s) 172
XcmI CCANNNNNNNNNTGG 1 cut(s) 160
XspI CTAG 2 cut(s) 237, 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.