MD03G1010700.v1.1

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0000726
Physical Location & Seq
Forward (+)
812029 .. 812610
582 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1010700.v1.1.491

Sequence Viewer

Length: 582 bp
ATGGCCAGAACACCTCAAATCGTGGCTACACAATTCATAATTCTCTCACTTCTATCTTCGTTTGCCCTAATTCTTGTCCAAGGAGATGATCACGATTTTGTCAGAGCCTTGGACCGCAAGCTTCTGGGTCTCGAGAAAGAGAAGTTCAGCCACTTTAAGATGTACTGGCACGACATTGTTGGCGGTCCAAATCCCAGTTCAGTTCCAGTGGTGAACCCACCAACCAATTCATCAACAGCGTTTGGTTTAATTACCATGATTGATAATCCACTCACTGAAGGGCCTGAATTGACCTCAAAATTACTGGGAAAGTCTCAAGGGTTCTATTCGTCTGCCTCACAGAAAGAACTTGGCCTGCTGATGGCCATGAATTTTCACTTCATACAAGGGAAGTACAATGGCAGCACTATAACGATTCTAGGAAGGAACCAGGTTTTCAACAAGGTGAGGGAGATGCCTGTCGTTGGAGGCAGTGGGCTTTTCAGGTTTGCAAGAGGTTATGCTGAAGCAAGAACTCATACGTTCACTCCAGCCACAGGAGATGCCACTGTGGAGTATAATATCTATGTGCTGCATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

194

Amino Acids

21.35

Weight (kDa)

8.83

Isoelectric Point (pI)

33.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 50 - 190 9.2e-57 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 115, 183
AcoI YGGCCR 2 cut(s) 3, 363
AcsI RAATTY 1 cut(s) 370
AcuI CTGAAG 2 cut(s) 297, 525
AfaI GTAC 2 cut(s) 164, 395
AfiI CCNNNNNNNGG 3 cut(s) 361, 464, 536
AgsI TTSAA 1 cut(s) 439
AjnI CCWGG 1 cut(s) 429
AjuI GAANNNNNNNTTGG 2 cut(s) 181, 213
AluBI AGCT 1 cut(s) 121
AluI AGCT 1 cut(s) 121
Alw26I GTCTC 2 cut(s) 134, 318
Ama87I CYCGRG 1 cut(s) 131
AoxI GGCC 4 cut(s) 3, 281, 352, 363
ApeKI GCWGC 2 cut(s) 402, 571
ApoI RAATTY 1 cut(s) 370
AspS9I GGNCC 3 cut(s) 112, 185, 281
AsuHPI GGTGA 2 cut(s) 223, 457
AvaI CYCGRG 1 cut(s) 131
AvaII GGWCC 2 cut(s) 112, 185
BalI TGGCCA 2 cut(s) 5, 365
BbvI GCAGC 2 cut(s) 414, 558
BccI CCATC 1 cut(s) 355
BciT130I CCWGG 1 cut(s) 431
BclI TGATCA 1 cut(s) 88
BcoDI GTCTC 2 cut(s) 134, 318
BfaI CTAG 1 cut(s) 419
BisI GCNGC 2 cut(s) 403, 572
BlsI GCNGC 2 cut(s) 404, 573
Bme1390I CCNGG 1 cut(s) 431
Bme18I GGWCC 2 cut(s) 112, 185
BmeT110I CYCGRG 1 cut(s) 131
BmgT120I GGNCC 3 cut(s) 112, 185, 281
BmiI GGNNCC 1 cut(s) 428
BmrFI CCNGG 1 cut(s) 431
BmrI ACTGGG 2 cut(s) 189, 314
BmsI GCATC 2 cut(s) 444, 532
BmuI ACTGGG 2 cut(s) 189, 314
BpmI CTGGAG 1 cut(s) 513
BpuEI CTTGAG 1 cut(s) 300
BsaI GGTCTC 1 cut(s) 134
BsaJI CCNNGG 2 cut(s) 79, 108
BsaXI ACNNNNNCTCC 2 cut(s) 511, 541
Bsc4I CCNNNNNNNGG 3 cut(s) 361, 464, 536
Bse1I ACTGG 4 cut(s) 170, 195, 206, 309
BseBI CCWGG 1 cut(s) 431
BseDI CCNNGG 2 cut(s) 79, 108
BseLI CCNNNNNNNGG 3 cut(s) 361, 464, 536
BseNI ACTGG 4 cut(s) 170, 195, 206, 309
BseXI GCAGC 2 cut(s) 414, 558
BshFI GGCC 4 cut(s) 5, 283, 354, 365
BsiHKCI CYCGRG 1 cut(s) 131
BslI CCNNNNNNNGG 3 cut(s) 361, 464, 536
BsmAI GTCTC 2 cut(s) 134, 318
BsnI GGCC 4 cut(s) 5, 283, 354, 365
Bso31I GGTCTC 1 cut(s) 134
BsoBI CYCGRG 1 cut(s) 131
Bsp143I GATC 1 cut(s) 88
BspACI CCGC 2 cut(s) 115, 183
BspANI GGCC 4 cut(s) 5, 283, 354, 365
BspLI GGNNCC 1 cut(s) 428
BspTNI GGTCTC 1 cut(s) 134
BsrI ACTGG 4 cut(s) 170, 195, 206, 309
BssECI CCNNGG 2 cut(s) 79, 108
BssMI GATC 1 cut(s) 88
BssT1I CCWWGG 2 cut(s) 79, 108
Bst2UI CCWGG 1 cut(s) 431
Bst4CI ACNGT 1 cut(s) 550
BstC8I GCNNGC 2 cut(s) 119, 356
BstKTI GATC 1 cut(s) 91
BstMAI GTCTC 2 cut(s) 134, 318
BstMBI GATC 1 cut(s) 88
BstNI CCWGG 1 cut(s) 431
BstSCI CCNGG 1 cut(s) 429
BstV1I GCAGC 2 cut(s) 414, 558
BsuRI GGCC 4 cut(s) 5, 283, 354, 365
BtsI GCAGTG 1 cut(s) 478
BtsIMutI CAGTG 4 cut(s) 213, 273, 478, 546
Cac8I GCNNGC 2 cut(s) 119, 356
Cfr13I GGNCC 3 cut(s) 112, 185, 281
CsiI ACCWGGT 1 cut(s) 429
Csp6I GTAC 2 cut(s) 163, 394
CviAII CATG 2 cut(s) 256, 367
CviQI GTAC 2 cut(s) 163, 394
DpnI GATC 1 cut(s) 90
DpnII GATC 1 cut(s) 88
EaeI YGGCCR 2 cut(s) 3, 363
Eco130I CCWWGG 2 cut(s) 79, 108
Eco31I GGTCTC 1 cut(s) 134
Eco47I GGWCC 2 cut(s) 112, 185
Eco57I CTGAAG 2 cut(s) 297, 525
Eco88I CYCGRG 1 cut(s) 131
EcoO109I RGGNCCY 1 cut(s) 281
EcoRII CCWGG 1 cut(s) 429
EcoT14I CCWWGG 2 cut(s) 79, 108
ErhI CCWWGG 2 cut(s) 79, 108
FaeI CATG 2 cut(s) 259, 370
FaiI YATR 9 cut(s) 38, 257, 368, 383, 410, 501, 519, 558, 567
FatI CATG 2 cut(s) 255, 366
FbaI TGATCA 1 cut(s) 88
Fnu4HI GCNGC 2 cut(s) 403, 572
Fsp4HI GCNGC 2 cut(s) 403, 572
FspBI CTAG 1 cut(s) 419
GluI GCNGC 2 cut(s) 403, 572
GsuI CTGGAG 1 cut(s) 513
HaeIII GGCC 4 cut(s) 5, 283, 354, 365
Hin1II CATG 2 cut(s) 259, 370
HindIII AAGCTT 1 cut(s) 119
HinfI GANTC 1 cut(s) 415
HphI GGTGA 2 cut(s) 223, 457
Hpy166II GTNNAC 2 cut(s) 214, 525
Hpy188I TCNGA 1 cut(s) 104
Hpy188III TCNNGA 3 cut(s) 92, 131, 133
Hpy8I GTNNAC 2 cut(s) 214, 525
HpyAV CCTTC 2 cut(s) 272, 417
HpyCH4III ACNGT 1 cut(s) 550
HpyCH4IV ACGT 1 cut(s) 521
HpyCH4V TGCA 2 cut(s) 491, 574
HpySE526I ACGT 1 cut(s) 521
Hsp92II CATG 2 cut(s) 259, 370
Ksp22I TGATCA 1 cut(s) 88
Kzo9I GATC 1 cut(s) 88
Lsp1109I GCAGC 2 cut(s) 414, 558
LweI GCATC 2 cut(s) 444, 532
MabI ACCWGGT 1 cut(s) 429
MaeI CTAG 1 cut(s) 419
MaeII ACGT 1 cut(s) 521
MalI GATC 1 cut(s) 90
MboI GATC 1 cut(s) 88
MboII GAAGA 1 cut(s) 48
MlsI TGGCCA 2 cut(s) 5, 365
MluCI AATT 8 cut(s) 32, 39, 69, 226, 249, 287, 299, 370
MluNI TGGCCA 2 cut(s) 5, 365
MmeI TCCRAC 1 cut(s) 445
MnlI CCTC 6 cut(s) 24, 304, 346, 441, 461, 488
Mox20I TGGCCA 2 cut(s) 5, 365
MscI TGGCCA 2 cut(s) 5, 365
MseI TTAA 2 cut(s) 156, 248
Msp20I TGGCCA 2 cut(s) 5, 365
MspR9I CCNGG 1 cut(s) 431
MvaI CCWGG 1 cut(s) 431
NdeII GATC 1 cut(s) 88
NlaIII CATG 2 cut(s) 259, 370
NlaIV GGNNCC 1 cut(s) 428
PaeR7I CTCGAG 1 cut(s) 131
PfeI GAWTC 1 cut(s) 415
PkrI GCNGC 2 cut(s) 404, 573
Psp6I CCWGG 1 cut(s) 429
PspGI CCWGG 1 cut(s) 429
PspN4I GGNNCC 1 cut(s) 428
PspPI GGNCC 3 cut(s) 112, 185, 281
RsaI GTAC 2 cut(s) 164, 395
RsaNI GTAC 2 cut(s) 163, 394
SaqAI TTAA 2 cut(s) 156, 248
SatI GCNGC 2 cut(s) 403, 572
Sau3AI GATC 1 cut(s) 88
Sau96I GGNCC 3 cut(s) 112, 185, 281
ScrFI CCNGG 1 cut(s) 431
SetI ASST 8 cut(s) 16, 123, 296, 435, 447, 488, 499, 524
SexAI ACCWGGT 1 cut(s) 429
SfaNI GCATC 2 cut(s) 444, 532
Sfr274I CTCGAG 1 cut(s) 131
SinI GGWCC 2 cut(s) 112, 185
SlaI CTCGAG 1 cut(s) 131
SmlI CTYRAG 2 cut(s) 131, 315
SmoI CTYRAG 2 cut(s) 131, 315
Sse9I AATT 8 cut(s) 32, 39, 69, 226, 249, 287, 299, 370
SsiI CCGC 2 cut(s) 115, 183
SspMI CTAG 1 cut(s) 419
StyD4I CCNGG 1 cut(s) 429
StyI CCWWGG 2 cut(s) 79, 108
TaaI ACNGT 1 cut(s) 550
TaiI ACGT 1 cut(s) 524
TaqI TCGA 1 cut(s) 132
TasI AATT 8 cut(s) 32, 39, 69, 226, 249, 287, 299, 370
TatI WGTACW 2 cut(s) 162, 393
TfiI GAWTC 1 cut(s) 415
Tru1I TTAA 2 cut(s) 156, 248
Tru9I TTAA 2 cut(s) 156, 248
TscAI CASTG 4 cut(s) 213, 280, 478, 553
TseI GCWGC 2 cut(s) 402, 571
TspDTI ATGAA 4 cut(s) 25, 219, 370, 383
TspRI CASTG 4 cut(s) 213, 280, 478, 553
VpaK11BI GGWCC 2 cut(s) 112, 185
XapI RAATTY 1 cut(s) 370
XhoI CTCGAG 1 cut(s) 131
XspI CTAG 1 cut(s) 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.