Rh5DG562300

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
86686521 .. 86687391
871 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG562300.1

Sequence Viewer

Length: 591 bp
ATGGCTAGAATCCTTCCCACCTTAGCTTTCCACTTGCTCATAATCGCTTCCCTCCTGTCTTCCTTTTCCATGATCTTAGTTTCTGCGGAAGATCATGAGTTTGTGAAATCCATGGACCCGGAGCTTTTCGGTTTAAAGAAAGAAAAGCTCACCCATTTTCGCTTGTATTGGCACGACGTTGTTGATGGTCCTAATCCCTCTGCCGTAACAATAGTGCAACCACCCTCCAACTCCTCCCAAACACGGTTCGGCCTAATAAGAATGTTCGACAACGCTCTAACCCAAGGCCCCGAACCGAGCTCGAAACTTCTGGGAAGGGCTCAAGGGTTTTATGGATCTGCTTCACAAGAAGACATTAGCCTGTTGATGGCTGAGAACTTTGCTTTTGTTCAGGGAAAGTATAACGGTAGCACCATAACCCTGATGGGGAGGAATTCGATCTTGAACAAAGTGAGGGAGCTATCTGTGATAGGAGGAAGTGGACTTTTCAGGTATGCTAGGGGTTATGCTCTAGCAACCACTCAGTCGTTTAATGCATCAAAAAGTGATGATGCTATAGTGGAGTACAATATCTATGTCTTGCATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

196

Amino Acids

21.7

Weight (kDa)

6.97

Isoelectric Point (pI)

36.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 51 - 193 6.3e-55 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 86
AclWI GGATC 1 cut(s) 343
AcsI RAATTY 1 cut(s) 433
AfaI GTAC 1 cut(s) 566
AfiI CCNNNNNNNGG 3 cut(s) 243, 367, 426
AgsI TTSAA 1 cut(s) 445
AluBI AGCT 5 cut(s) 26, 124, 148, 300, 460
AluI AGCT 5 cut(s) 26, 124, 148, 300, 460
Alw21I GWGCWC 1 cut(s) 302
AlwI GGATC 1 cut(s) 343
AoxI GGCC 2 cut(s) 250, 286
ApoI RAATTY 1 cut(s) 433
AspS9I GGNCC 3 cut(s) 115, 188, 287
AsuC2I CCSGG 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 142
AvaII GGWCC 2 cut(s) 115, 188
BanII GRGCYC 2 cut(s) 302, 322
BbsI GAAGAC 2 cut(s) 51, 357
Bbv12I GWGCWC 1 cut(s) 302
BccI CCATC 3 cut(s) 179, 361, 418
BceAI ACGGC 1 cut(s) 188
BcnI CCSGG 1 cut(s) 119
BfaI CTAG 3 cut(s) 6, 498, 512
BfmI CTRYAG 1 cut(s) 555
Bme1390I CCNGG 1 cut(s) 119
Bme18I GGWCC 2 cut(s) 115, 188
BmgT120I GGNCC 3 cut(s) 115, 188, 287
BmiI GGNNCC 2 cut(s) 117, 289
BmrFI CCNGG 1 cut(s) 119
BmsI GCATC 2 cut(s) 541, 545
BpiI GAAGAC 2 cut(s) 51, 357
Bpu10I CCTNAGC 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 306
BpuMI CCSGG 1 cut(s) 119
BsaJI CCNNGG 2 cut(s) 111, 283
Bsc4I CCNNNNNNNGG 3 cut(s) 243, 367, 426
BseDI CCNNGG 2 cut(s) 111, 283
BseLI CCNNNNNNNGG 3 cut(s) 243, 367, 426
BseMII CTCAG 2 cut(s) 363, 536
BseRI GAGGAG 1 cut(s) 223
BshFI GGCC 2 cut(s) 252, 288
BsiHKAI GWGCWC 1 cut(s) 302
BsiSI CCGG 1 cut(s) 119
BslI CCNNNNNNNGG 3 cut(s) 243, 367, 426
BsnI GGCC 2 cut(s) 252, 288
Bsp1286I GDGCHC 2 cut(s) 302, 322
Bsp143I GATC 4 cut(s) 72, 91, 335, 438
Bsp19I CCATGG 1 cut(s) 111
BspACI CCGC 1 cut(s) 86
BspANI GGCC 2 cut(s) 252, 288
BspCNI CTCAG 2 cut(s) 364, 535
BspHI TCATGA 1 cut(s) 94
BspLI GGNNCC 2 cut(s) 117, 289
BspPI GGATC 1 cut(s) 343
BssECI CCNNGG 2 cut(s) 111, 283
BssMI GATC 4 cut(s) 72, 91, 335, 438
BssT1I CCWWGG 2 cut(s) 111, 283
Bst4CI ACNGT 2 cut(s) 246, 407
BstDEI CTNAG 4 cut(s) 22, 76, 372, 522
BstDSI CCRYGG 1 cut(s) 111
BstKTI GATC 4 cut(s) 75, 94, 338, 441
BstMBI GATC 4 cut(s) 72, 91, 335, 438
BstSCI CCNGG 1 cut(s) 117
BstSFI CTRYAG 1 cut(s) 555
BstV2I GAAGAC 2 cut(s) 51, 357
BstX2I RGATCY 1 cut(s) 335
BstYI RGATCY 1 cut(s) 335
BsuRI GGCC 2 cut(s) 252, 288
BtgI CCRYGG 1 cut(s) 111
CciI TCATGA 1 cut(s) 94
Cfr13I GGNCC 3 cut(s) 115, 188, 287
Csp6I GTAC 1 cut(s) 565
CviAII CATG 3 cut(s) 70, 95, 112
CviQI GTAC 1 cut(s) 565
DdeI CTNAG 4 cut(s) 22, 76, 372, 522
DpnI GATC 4 cut(s) 74, 93, 337, 440
DpnII GATC 4 cut(s) 72, 91, 335, 438
DraI TTTAAA 1 cut(s) 135
Ecl136II GAGCTC 1 cut(s) 300
Eco130I CCWWGG 2 cut(s) 111, 283
Eco24I GRGCYC 2 cut(s) 302, 322
Eco47I GGWCC 2 cut(s) 115, 188
Eco53kI GAGCTC 1 cut(s) 300
EcoICRI GAGCTC 1 cut(s) 300
EcoO109I RGGNCCY 1 cut(s) 287
EcoRI GAATTC 1 cut(s) 433
EcoT14I CCWWGG 2 cut(s) 111, 283
EcoT22I ATGCAT 1 cut(s) 538
EcoT38I GRGCYC 2 cut(s) 302, 322
ErhI CCWWGG 2 cut(s) 111, 283
FaeI CATG 3 cut(s) 73, 98, 115
FatI CATG 3 cut(s) 69, 94, 111
FriOI GRGCYC 2 cut(s) 302, 322
FspBI CTAG 3 cut(s) 6, 498, 512
HaeIII GGCC 2 cut(s) 252, 288
HapII CCGG 1 cut(s) 119
Hin1II CATG 3 cut(s) 73, 98, 115
HinfI GANTC 1 cut(s) 9
HpaII CCGG 1 cut(s) 119
HphI GGTGA 1 cut(s) 142
Hpy166II GTNNAC 1 cut(s) 482
Hpy188III TCNNGA 2 cut(s) 95, 442
Hpy8I GTNNAC 1 cut(s) 482
Hpy99I CGWCG 1 cut(s) 179
HpyAV CCTTC 2 cut(s) 23, 309
HpyCH4III ACNGT 2 cut(s) 246, 407
HpyCH4IV ACGT 1 cut(s) 177
HpyCH4V TGCA 3 cut(s) 217, 536, 583
HpyF3I CTNAG 4 cut(s) 22, 76, 372, 522
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 3 cut(s) 73, 98, 115
Kzo9I GATC 4 cut(s) 72, 91, 335, 438
LmnI GCTCC 2 cut(s) 121, 457
LpnPI CCDG 7 cut(s) 68, 132, 296, 374, 377, 434, 475
LweI GCATC 2 cut(s) 541, 545
MaeI CTAG 3 cut(s) 6, 498, 512
MaeII ACGT 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 205
MalI GATC 4 cut(s) 74, 93, 337, 440
MboI GATC 4 cut(s) 72, 91, 335, 438
MboII GAAGA 3 cut(s) 51, 101, 362
MflI RGATCY 1 cut(s) 335
MhlI GDGCHC 2 cut(s) 302, 322
MluCI AATT 1 cut(s) 433
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 7 cut(s) 62, 208, 235, 244, 423, 447, 467
Mph1103I ATGCAT 1 cut(s) 538
MseI TTAA 2 cut(s) 134, 531
MspI CCGG 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 119
NciI CCSGG 1 cut(s) 119
NcoI CCATGG 1 cut(s) 111
NdeII GATC 4 cut(s) 72, 91, 335, 438
NlaIII CATG 3 cut(s) 73, 98, 115
NlaIV GGNNCC 2 cut(s) 117, 289
NsiI ATGCAT 1 cut(s) 538
PagI TCATGA 1 cut(s) 94
PfeI GAWTC 1 cut(s) 9
Psp124BI GAGCTC 1 cut(s) 302
PspN4I GGNNCC 2 cut(s) 117, 289
PspPI GGNCC 3 cut(s) 115, 188, 287
PsuI RGATCY 1 cut(s) 335
RsaI GTAC 1 cut(s) 566
RsaNI GTAC 1 cut(s) 565
SacI GAGCTC 1 cut(s) 302
SaqAI TTAA 2 cut(s) 134, 531
Sau3AI GATC 4 cut(s) 72, 91, 335, 438
Sau96I GGNCC 3 cut(s) 115, 188, 287
ScrFI CCNGG 1 cut(s) 119
SduI GDGCHC 2 cut(s) 302, 322
SetI ASST 8 cut(s) 23, 28, 126, 150, 180, 302, 462, 494
SfaNI GCATC 2 cut(s) 541, 545
SfcI CTRYAG 1 cut(s) 555
SinI GGWCC 2 cut(s) 115, 188
SmlI CTYRAG 1 cut(s) 321
SmoI CTYRAG 1 cut(s) 321
Sse9I AATT 1 cut(s) 433
SsiI CCGC 1 cut(s) 86
SspMI CTAG 3 cut(s) 6, 498, 512
SstI GAGCTC 1 cut(s) 302
StyD4I CCNGG 1 cut(s) 117
StyI CCWWGG 2 cut(s) 111, 283
TaaI ACNGT 2 cut(s) 246, 407
TaiI ACGT 1 cut(s) 180
TaqI TCGA 3 cut(s) 267, 302, 437
TasI AATT 1 cut(s) 433
TatI WGTACW 1 cut(s) 564
TfiI GAWTC 1 cut(s) 9
Tru1I TTAA 2 cut(s) 134, 531
Tru9I TTAA 2 cut(s) 134, 531
VpaK11BI GGWCC 2 cut(s) 115, 188
XapI RAATTY 1 cut(s) 433
XcmI CCANNNNNNNNNTGG 1 cut(s) 421
XspI CTAG 3 cut(s) 6, 498, 512
Zsp2I ATGCAT 1 cut(s) 538
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.