AT3G13660

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
4464797 .. 4465791
995 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G13660.1

Sequence Viewer

Length: 378 bp
ATGATTCAGAAGGCGGTTTCAAACTCCTCAACCTCCTTCGGATCAATCACAATGACGGACAACGCACTAACATCTGATGTGCCCGTTAACTCGACTGTGGTAGGCCAGTCCCAAGGTTTTTACGCTGGAGCGGCCCAACGTGAGCTAGGCTTCTTGATGGCGATGAATTTCGCTTTCAAAACAGGGAAGTACAATGGGAGTACGATCACAATTCTTGGCCGGAACACGGTGTTCTCGAAGGTTAGGGAAATGACGGTGGTCGGAGGAAGTGGAATCTTCCGGTTAGCTAGAGGTTATGTCGAGGCTAGGACTAAGTGGTTCGATCCTAAGACAGGAGACGCCACTGTTGAATACAATTGTTATGTCTTGCATTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

13.6

Weight (kDa)

9.37

Isoelectric Point (pI)

21.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 6 - 122 3.1e-43 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 131
AciI CCGC 2 cut(s) 14, 131
AclWI GGATC 2 cut(s) 49, 317
AcoI YGGCCR 1 cut(s) 217
AcsI RAATTY 1 cut(s) 166
AcyI GRCGYC 1 cut(s) 339
AfaI GTAC 2 cut(s) 191, 202
AfiI CCNNNNNNNGG 2 cut(s) 226, 332
AgsI TTSAA 3 cut(s) 21, 178, 350
AluBI AGCT 2 cut(s) 145, 287
AluI AGCT 2 cut(s) 145, 287
Alw26I GTCTC 1 cut(s) 330
AlwI GGATC 2 cut(s) 49, 317
AoxI GGCC 3 cut(s) 103, 132, 217
ApoI RAATTY 1 cut(s) 166
AspS9I GGNCC 1 cut(s) 133
BaeGI GKGCMC 1 cut(s) 84
BccI CCATC 1 cut(s) 151
BcoDI GTCTC 1 cut(s) 330
BfaI CTAG 3 cut(s) 146, 288, 306
BisI GCNGC 1 cut(s) 132
BlsI GCNGC 1 cut(s) 133
BmgT120I GGNCC 1 cut(s) 133
BoxI GACNNNNGTC 1 cut(s) 257
BpmI CTGGAG 1 cut(s) 147
BsaHI GRCGYC 1 cut(s) 339
BsaJI CCNNGG 1 cut(s) 112
BsaWI WCCGGW 1 cut(s) 279
Bsc4I CCNNNNNNNGG 2 cut(s) 226, 332
Bse1I ACTGG 1 cut(s) 106
BseDI CCNNGG 1 cut(s) 112
BseLI CCNNNNNNNGG 2 cut(s) 226, 332
BseNI ACTGG 1 cut(s) 106
BseRI GAGGAG 1 cut(s) 16
BseSI GKGCMC 1 cut(s) 84
BshFI GGCC 3 cut(s) 105, 134, 219
BsiSI CCGG 2 cut(s) 220, 280
BslFI GGGAC 1 cut(s) 94
BslI CCNNNNNNNGG 2 cut(s) 226, 332
BsmAI GTCTC 1 cut(s) 330
BsmBI CGTCTC 1 cut(s) 330
BsmFI GGGAC 1 cut(s) 94
BsnI GGCC 3 cut(s) 105, 134, 219
Bsp1286I GDGCHC 1 cut(s) 84
Bsp143I GATC 3 cut(s) 41, 204, 322
BspACI CCGC 2 cut(s) 14, 131
BspANI GGCC 3 cut(s) 105, 134, 219
BspPI GGATC 2 cut(s) 49, 317
BsrBI CCGCTC 1 cut(s) 131
BsrI ACTGG 1 cut(s) 106
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 3 cut(s) 41, 204, 322
BssNI GRCGYC 1 cut(s) 339
BssT1I CCWWGG 1 cut(s) 112
Bst4CI ACNGT 4 cut(s) 97, 229, 256, 346
BstACI GRCGYC 1 cut(s) 339
BstDEI CTNAG 2 cut(s) 312, 327
BstENI CCTNNNNNAGG 1 cut(s) 330
BstKTI GATC 3 cut(s) 44, 207, 325
BstMAI GTCTC 1 cut(s) 330
BstMBI GATC 3 cut(s) 41, 204, 322
BstMWI GCNNNNNNNGC 1 cut(s) 131
BstPAI GACNNNNGTC 1 cut(s) 257
BstSLI GKGCMC 1 cut(s) 84
BsuRI GGCC 3 cut(s) 105, 134, 219
BtgZI GCGATG 1 cut(s) 176
BtsIMutI CAGTG 1 cut(s) 342
Cfr13I GGNCC 1 cut(s) 133
CseI GACGC 1 cut(s) 347
Csp6I GTAC 2 cut(s) 190, 201
CviJI RGCY 7 cut(s) 105, 134, 145, 150, 219, 287, 305
CviKI_1 RGCY 7 cut(s) 105, 134, 145, 150, 219, 287, 305
CviQI GTAC 2 cut(s) 190, 201
DdeI CTNAG 2 cut(s) 312, 327
DpnI GATC 3 cut(s) 43, 206, 324
DpnII GATC 3 cut(s) 41, 204, 322
EaeI YGGCCR 1 cut(s) 217
Eco130I CCWWGG 1 cut(s) 112
EcoNI CCTNNNNNAGG 1 cut(s) 330
EcoT14I CCWWGG 1 cut(s) 112
ErhI CCWWGG 1 cut(s) 112
Esp3I CGTCTC 1 cut(s) 330
FaiI YATR 2 cut(s) 297, 363
FaqI GGGAC 1 cut(s) 94
Fnu4HI GCNGC 1 cut(s) 132
Fsp4HI GCNGC 1 cut(s) 132
FspBI CTAG 3 cut(s) 146, 288, 306
GluI GCNGC 1 cut(s) 132
GsuI CTGGAG 1 cut(s) 147
HaeIII GGCC 3 cut(s) 105, 134, 219
HapII CCGG 2 cut(s) 220, 280
HgaI GACGC 1 cut(s) 347
Hin1I GRCGYC 1 cut(s) 339
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HinfI GANTC 2 cut(s) 4, 273
HpaI GTTAAC 1 cut(s) 88
HpaII CCGG 2 cut(s) 220, 280
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 4 cut(s) 9, 41, 76, 263
Hpy188III TCNNGA 2 cut(s) 154, 235
Hpy8I GTNNAC 1 cut(s) 88
HpyAV CCTTC 3 cut(s) 4, 46, 232
HpyCH4III ACNGT 4 cut(s) 97, 229, 256, 346
HpyCH4IV ACGT 1 cut(s) 139
HpyCH4V TGCA 1 cut(s) 370
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
HpyF3I CTNAG 2 cut(s) 312, 327
HpySE526I ACGT 1 cut(s) 139
Hsp92I GRCGYC 1 cut(s) 339
KspAI GTTAAC 1 cut(s) 88
Kzo9I GATC 3 cut(s) 41, 204, 322
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 6 cut(s) 111, 119, 168, 233, 293, 318
MaeI CTAG 3 cut(s) 146, 288, 306
MaeII ACGT 1 cut(s) 139
MalI GATC 3 cut(s) 43, 206, 324
MbiI CCGCTC 1 cut(s) 131
MboI GATC 3 cut(s) 41, 204, 322
MboII GAAGA 1 cut(s) 268
MfeI CAATTG 1 cut(s) 355
MhlI GDGCHC 1 cut(s) 84
MluCI AATT 3 cut(s) 166, 210, 355
MmeI TCCRAC 1 cut(s) 241
MnlI CCTC 5 cut(s) 37, 43, 257, 284, 295
MseI TTAA 1 cut(s) 87
MspI CCGG 2 cut(s) 220, 280
MunI CAATTG 1 cut(s) 355
MwoI GCNNNNNNNGC 1 cut(s) 131
NdeII GATC 3 cut(s) 41, 204, 322
PcsI WCGNNNNNNNCGW 1 cut(s) 233
PfeI GAWTC 2 cut(s) 4, 273
PkrI GCNGC 1 cut(s) 133
PshAI GACNNNNGTC 1 cut(s) 257
PspPI GGNCC 1 cut(s) 133
RsaI GTAC 2 cut(s) 191, 202
RsaNI GTAC 2 cut(s) 190, 201
SaqAI TTAA 1 cut(s) 87
SatI GCNGC 1 cut(s) 132
Sau3AI GATC 3 cut(s) 41, 204, 322
Sau96I GGNCC 1 cut(s) 133
SduI GDGCHC 1 cut(s) 84
SetI ASST 7 cut(s) 35, 118, 142, 147, 243, 289, 295
Sse9I AATT 3 cut(s) 166, 210, 355
SsiI CCGC 2 cut(s) 14, 131
SspMI CTAG 3 cut(s) 146, 288, 306
StyI CCWWGG 1 cut(s) 112
TaaI ACNGT 4 cut(s) 97, 229, 256, 346
TaiI ACGT 1 cut(s) 142
TaqI TCGA 4 cut(s) 92, 236, 300, 321
TasI AATT 3 cut(s) 166, 210, 355
TatI WGTACW 1 cut(s) 189
TauI GCSGC 1 cut(s) 134
TfiI GAWTC 2 cut(s) 4, 273
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TscAI CASTG 1 cut(s) 349
TspDTI ATGAA 1 cut(s) 179
TspGWI ACGGA 1 cut(s) 71
TspRI CASTG 1 cut(s) 349
XagI CCTNNNNNAGG 1 cut(s) 330
XapI RAATTY 1 cut(s) 166
XspI CTAG 3 cut(s) 146, 288, 306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.